We narrowed to 561 results for: PA-GFP
-
Plasmid#192788PurposeaGFP nanobody enhancer tagged with cysteine, YbbR and H6 for bacterial expression, purification and labelingDepositorInsertantiGFP nanobody enhancer
TagsH6 and ybbRExpressionBacterialAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pet21a-aGFPnb-minimizer-cys-linker-YbbR-(PAS)5-H6
Plasmid#192789PurposeaGFP nanobody minimizer tagged with cysteine, YbbR and H6 for bacterial expression, purification and labelingDepositorInsertantiGFP nanobody minimizer
TagsH6 and ybbRExpressionBacterialAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-eGFP-hTau-WPRE-pA
Plasmid#255025PurposeLentiviral plasmid designed to express a fusion protein of enhanced GFP and human TauDepositorInsertTau/MAPT (MAPT Human)
UseLentiviralAvailable SinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-H2B-GFP-WPRE-pA
Plasmid#242690PurposeExpression of H2B-GFP for nuclei isolationDepositorAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(mito, G108V)
Plasmid#233343PurposeStable expression of EGFP-LOV2(N538E)-BAX(G108V)-OMP25 in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationN-terminus and C-terminus are deleted. BAX(3-171)…Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6/TO-shEsr1-CMV-TetR-eGFP
Plasmid#233298PurposeDOX-inducible U6 driven shRNA against mouse Esr1DepositorAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP5002 RabV-SADdeltaG-histone-EGFP
Plasmid#176284PurposeRecombinant rabies virus expressing histone-EGFPDepositorAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-C1-DGKd2
Plasmid#224897PurposeExpress N-terminal mCherry fused to human diacylglycerol kinase delta isoform 2 in mammalian cellsDepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP228-Lenti-CMV-GFP-GluN2B-WPRE-pA
Plasmid#84277PurposepLenti vector backbone designed to express GFP tagged GluN2B from a CMV promoter.DepositorInsertGluN2B
UseLentiviralTagsGFPPromoterCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP227-Lenti-CMV-GFP-GluN2A-WPRE-pA
Plasmid#84276PurposepLenti vector backbone designed to express GFP tagged GluN2A from a CMV promoter.DepositorInsertGluN2A
UseLentiviralTagsGFPPromoterCMVAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KA801: pMVP (L3-L2) HA tag + pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121800PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream CMV-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + CMV::eGFP-P2A-TETa-polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_PA-mEGFP-CAMSAP3
Plasmid#255812Purposemammalian expression of CAMSAP3 tagged with PA and mEGFPDepositorAvailable SinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_PA-mEGFP-CAMSAP2
Plasmid#255811Purposemammalian expression of CAMSAP2 tagged with PA and mEGFPDepositorAvailable SinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pN1_PA-MAP7-mEGFP
Plasmid#255809Purposemammalian expression of MAP7 tagged with PA and mEGFPDepositorAvailable SinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_PA-MAP2-mEGFP
Plasmid#255808Purposemammalian expression of MAP2 tagged with PA and mEGFPDepositorAvailable SinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_PA-mEGFP-Tau
Plasmid#255810Purposemammalian expression of Tau tagged with PA and mEGFPDepositorAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgGFP
Plasmid#213165PurposeVector with sgGFP for induction of global DNA methylation.DepositorInsertsgGFP
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6 and PGKAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
P30.pA.NGFR-mSrtA.mCMV.hPGK.GFP.wpre
Plasmid#226728Purposebackbone vector, GFP expressionDepositorTypeEmpty backboneExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only