We narrowed to 34,848 results for: CaS;
-
Plasmid#169424PurposeExpression of Cas9 and 2 guidesDepositorInsertspCas9
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX165-Sniper-Cas9
Plasmid#140560PurposeExpresses Sniper Cas9 in mammalian cellsDepositorInsertCas9
UseTagsExpressionMutationF539S M763I K890NPromoterAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CibN-dCas9
Plasmid#60551PurposeExpresses CibN-dCas9 in mammalian cellsDepositorInsertCibN-dCas9
UseCRISPRTagsFLAG and SV40 NLSExpressionMammalianMutationinactivating Cas9 mutations D10A and H840APromoterCMVAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SP6-hCas9-Ce-mRNA
Plasmid#47911PurposeIn vitro transcription of a mRNA encoding humanized Cas9 nuclease, with 3' UTRs suitable for germline expression in C. elegans, for doing CRISPR-Cas by RNA injection. Uses SP6 RNA polymerase.DepositorInserthCas9 with C. elegans 5' and 3' UTRs
UseCRISPRTagsExpressionMutationPromoterSP6Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-efSaCas9-BlastR
Plasmid#220971PurposeExpresses human codon-optimized efSaCas9DepositorInsertefSaCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-a5 guide B
Plasmid#194011PurposeFor CRISPR knockout of integrin alpha5DepositorInsertsingle-guide RNA (a5_guide B)
UseCRISPRTagsExpressionMutationPromoterAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-aV guide A
Plasmid#194008PurposeFor CRISPR knockout of integrin alphaVDepositorInsertsingle-guide RNA (aV_guide A)
UseCRISPRTagsExpressionMutationPromoterAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-aV guide B
Plasmid#194009PurposeFor CRISPR knockout of integrin alphaVDepositorInsertsingle-guide RNA (aV_guide B)
UseCRISPRTagsExpressionMutationPromoterAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only