We narrowed to 5,296 results for: mag
-
Plasmid#73315PurposePas2p peroxisomal membrane biogenesis proteinDepositorInsertPas2p peroxisomal membrane targeting protein
TagsHis6 and c-mycExpressionYeastMutationEncodes a glycine-204 to serine mutationPromoterAOX1Available sinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_eGFP::Dpp
Plasmid#163702PurposeGFP-tagged version of Dpp (Decapentaplegic) under control of UAS and LexO enhancersDepositorAvailable sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable sinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUE001-Dendra2Hfx
Plasmid#234669Purposeencodes Dendra2Hfx in Haloferax volcanii under the tryptophan inducible p.tna promoter, trpA, ampR, shuttle vector for E.coliDepositorInsertDendra2Hfx
UseArchaeal expression in haloferax volcaniiTagsDendra2HfxPromoterp.tnaAvailable sinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TUSC3
Plasmid#132304PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertTUSC3 (TUSC3 Human)
ExpressionMammalianAvailable sinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pFN18a-HaloTag-(protein L)8-SpyTag
Plasmid#240512PurposeBacterial expression of HaloTag-(protein L)8-SpyTag-HisTag-Cys used as calibration standard for magnetic tweezersDepositorInserteight repeats of B1 domain of Protein L located between HaloTag and SpyTag
TagsCysteine, HaloTag, HisTag, and SpyTagExpressionBacterialAvailable sinceAug. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
HCA2-DuET
Plasmid#213308PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based no force control)
Plasmid#118718PurposeThe donor (YPet(short)) only control for the no force control of the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based tension sensor)
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUE001-Cas1:Dendra2Hfx
Plasmid#234670Purposeencodes Cas1:Dendra2Hfx fusion in Haloferax volcanii under the tryptophan inducible p.tna promoter, trpA, ampR, shuttle vector for E.coliDepositorInsertCas1
UseArcheal expression in haloferax volcaniiTagsDendra2HfxPromoterp.tnaAvailable sinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUE001-FtsZ1:Dendra2Hfx
Plasmid#234671Purposeencodes FtsZ1:Dendra2Hfx fusion in Haloferax volcanii under the tryptophan inducible p.tna promoter, trpA, ampR, shuttle vector for E.coliDepositorInsertFtsZ1
UseArcheal expression in haloferax volcaniiTagsDendra2HfxPromoterp.tnaAvailable sinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMH004_phiC31_neo-HS4-5xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179432PurposeDual fluorescent reporter construct with double HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertHS4-TRE-cit-HS4-mch (DH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH003_phiC31_neo-5xTetO-pEF-H2B-mCitrine-coreHS4-pRSV-H2B-mCherry
Plasmid#179431PurposeDual fluorescent reporter construct with single core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-coreHS4-mch (SC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based tension sensor)
Plasmid#118717PurposeThe donor (YPet(short)) only control for the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-F40-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-ICL1-LacI-Mit1AD
Plasmid#126721PurposeLacI-Mit1AD on pPICZ B expression vectorDepositorInserthybrid lacI-Mit1 activation domain coding sequence
ExpressionYeastPromoterICL1Available sinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK_P-GAP-LM_lacO-cP-AOX1-sAR
Plasmid#126745Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
Tags6xHisExpressionYeastPromoterGAPAvailable sinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK_P-ICL1-LM_lacO-cP-AOX1-sAR
Plasmid#126744Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
Tags6xHisExpressionYeastPromoterICL1Available sinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR1-Nterm 6xHis PL K16TAG-T500
Plasmid#92315PurposeExpression of NTerm 6xHis tagged protein L (PL) mutant K16TAG for ncAA incoporation using the p70a promoter and UTR1DepositorInsertB1 domain of protein L (PL) mutant K16TAG
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70b (p70a promoter with one mutation)Available sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only