We narrowed to 10,928 results for: cat.1
-
Plasmid#141608PurposeLentiviral vector for overexpressing the CTCFL transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF0411
Plasmid#141609PurposeLentiviral vector for overexpressing the CTCFL transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0407
Plasmid#141607PurposeLentiviral vector for overexpressing the CTCFL transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0364
Plasmid#141590PurposeLentiviral vector for overexpressing the TCEB1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a Cdk2ap1CAN-MutTER
Plasmid#178033PurposeExpression vector for the purpose of protein purification.DepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseNonviralTags6xHIS - Thrombin - MBP- TEV-TRSExpressionBacterialMutationChanged T(108)A, E(109)A, R(110)APromoterT7LacIAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a Cdk2ap1ΔN (MT2B2)
Plasmid#178034PurposeExpression vector for the purpose of protein purification.DepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseNonviralTags6xHIS - Thrombin - MBP- TEV-TRSExpressionBacterialMutationFirst N-Terminal 27aa are deletedPromoterT7LacIAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
BiFC1
Plasmid#190046PurposeBiFC plasmid for N-terminal tagging of genes with yEmVenus (aa 1–172)DepositorInsertYemVenus (aa1-172)
ExpressionYeastPromoterMet3Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
RGG-BcLOV-mCh
Plasmid#208276PurposeExpresses RGG-BcLOV fusion for optogenetic membrane recruitment. Includes an mCherry tag.DepositorInsertRGG-BcLOV-mCh
ExpressionMammalianPromoterpCMVAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB402-er-mCherry
Plasmid#186288PurposeBinary vector for the expression of er-mCherry (SP-mCherry-HDEL) in plants (for Agrobacterium-mediated genetic transformation and visualization of endoplasmic reticulum)DepositorInserter-mCherry
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFlagCMV2-UbcH13
Plasmid#12460DepositorAvailable SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLP1
Plasmid#209988PurposeEntry vector to store Level 0 partsDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
YFP Gamma 9
Plasmid#36107DepositorInsertG protein subunit Gamma 9
TagsYFPExpressionMammalianMutationHIs tag between YFP and insertPromoterCMVAvailable SinceMay 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
Fus-BcLOV-mCh
Plasmid#208277PurposeExpresses Fus-BcLOV fusion for optogenetic membrane recruitment. Includes an mCherry tag.DepositorInsertFus-BcLOV-mCh
ExpressionMammalianPromoterpCMVAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSynapsin flexed SV-tag
Plasmid#163686Purposeexpress SV-Tag construct in a Cre-dependent mannerDepositorInsertsynaptophysin 9X HA
UseAAVTags9X HAExpressionMammalianPromotersynapsinAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSynapsin SV-tag
Plasmid#163685Purposeexpress SV-Tag construct in a Cre-independent mannerDepositorInsertsynatophysin 9X HA tag T2A tdtomato
UseAAVTags9X HAExpressionMammalianPromotersynapsinAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA2.1
Plasmid#64117PurposeVector for expression of St1 sgRNA2.1 in mammalian cellsDepositorInsertSt1 sgRNA2.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMC-XII1
Plasmid#176159Purposepreassembled yeast MoClo level-2 backbone with GFP dropout for genomic integration in site XII-1DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA1.1
Plasmid#64116PurposeVector for expression of St1 sgRNA1.1 in mammalian cellsDepositorInsertSt1 sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMC-XI1
Plasmid#176155Purposepreassembled yeast MoClo level-2 backbone with GFP dropout for genomic integration in site XI-1DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCASBP-AP (E) (CC#39)
Plasmid#15162DepositorInsertPLAP (ALPP Human)
UseRetroviral; Avian expressionAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
Venus-Gprotein Gamma 9
Plasmid#42201DepositorInsertG protein Gamma 9
TagsVenus(1-155)ExpressionMammalianPromoterCMVAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMVTCRb_candidate1
Plasmid#164996PurposeExpression of candidate TCR #1 TCRbeta cDNADepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMVTCRa_candidate1
Plasmid#164995PurposeExpression of candidate TCR #1 TCRalpha cDNADepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS306:Met3p-mCherry-Tub1
Plasmid#37554DepositorInsertMet3p-mCherry-Tub1
ExpressionBacterialAvailable SinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS303:VC
Plasmid#37556DepositorInsertVenus C-term (aa 155-238)
ExpressionBacterialAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGWB602-MpPHOT-3xFLAG
Plasmid#228474PurposeMpPHOT-3xFLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter (for Agrobacterium-mediated genetic transformation.)DepositorInsertMpPHOT-3xFLAG
ExpressionBacterial and PlantAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB302-er-mCherry
Plasmid#186287PurposeBinary vector for the expression of er-mCherry (SP-mCherry-HDEL) in plants (for Agrobacterium-mediated genetic transformation and visualization of endoplasmic reticulum)DepositorInserter-mCherry
ExpressionBacterialAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
1026M=U6-3-gRNA#2[Pol-γ35]
Plasmid#159675PurposePlasmid supports expression of gRNA targeting Pol-γ35 site #2, tagged with mini-White, and can be integrated with phC31.DepositorInsertU6-3-gRNA#2[Pol-γ35]
UseCRISPRExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A500(KaganF60)
Plasmid#52003PurposeExpresses the human MAVS CDS containing a point mutation M1A and a C-terminal deletion removing the transmembrane domainDepositorInsertMAVS-M1A-500
ExpressionMammalianMutationchanged Met 1 to Ala and deleted the C-terminal t…Available SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MAVS-M1A,M142A(KaganE20)
Plasmid#52011PurposeExpresses the human MAVS CDS containing the point mutations M1A and M142ADepositorInsertMAVS-M1A,M142A
UseRetroviralExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4
Plasmid#48744PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to +1536 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to +1536)
UseLuciferaseMutationtruncated promoter region (see pGL6)Available SinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL3
Plasmid#48743PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to +1060 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to +1060)
UseLuciferaseMutationtruncated promoter region (see pGL6)Available SinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL2
Plasmid#48742PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to +386 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to +386)
UseLuciferaseMutationtruncated promoter region (see pGL6)Available SinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL1
Plasmid#48741PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to -141 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to -141)
UseLuciferaseMutationtruncated promoter region (see pGL6)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL5
Plasmid#48745PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to +2064 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to +2064)
UseLuciferaseMutationtruncated promoter region (see pGL6)Available SinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-humanized
Plasmid#44246PurposeExpression of a catalytically inactive, human codon-optimized Cas9 under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdownDepositorInsertdead Cas9 with 3X NLS
UseCRISPR and Retroviral; VectorTags3x NLSExpressionMammalianMutationD10A H840A (catalytically inactive)PromoterMSCV LTR promoterAvailable SinceApril 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-CUL1 K720A
Plasmid#19939DepositorInsertcullin 1 K720A (CUL1 Human)
TagsHA2ExpressionMammalianMutationCUL1 with a NEDD8 modification mutantAvailable SinceApril 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only