We narrowed to 1,487 results for: aav vector plasmid
-
Plasmid#186186PurposeAAV vector packaging AkaLuciferase under the TRE promoterDepositorInsertAkaLuc luciferase
UseAAVPromoterTRE-Tight2Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-FbLAG16
Plasmid#220749PurposeNIR-FbLAG16 expression in mammalian cells. pAAV vector.DepositorInsertNIR-FbLAG16
UseAAV and Affinity Reagent/ AntibodyPromoterCAGAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-FbLAG30
Plasmid#220750PurposeNIR-FbLAG30 expression in mammalian cells. pAAV vector.DepositorInsertNIR-FbLAG30
UseAAV and Affinity Reagent/ AntibodyPromoterCAGAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-flex-GFP-4x6T
Plasmid#196418PurposeCre-dependent AAV expression of GFP preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassetteDepositorInsertGFP
UseAAV and Cre/Lox; Astrocyte-selectiveExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Htr5b(3.7)-EGFP-sv40
Plasmid#184411PurposeAAV expression of EGFP from mouse 5-hydroxytryptamine (serotonin) receptor 5B (Htr5b) gene promoter.DepositorInsertMouse Htr5b gene promoter-EGFP (Htr5b Mouse)
UseAAVTagsEGFPExpressionMammalianPromoterMouse Htr5b geneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Susd4(3.7)-EGFP-sv40
Plasmid#184413PurposeAAV expression of tTA from mouse sushi domain containing 4 (Susd4) gene promoter.DepositorInsertMouse Susd4 gene promoter-EGFP (Susd4 Mouse)
UseAAVTagsEGFPExpressionMammalianPromoterMouse Susd4 geneAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-HA-mCherry-pA
Plasmid#233028PurposeTo Express HA tagged CasRX-mCherry fusion protein from the mammalian EFS promoterDepositorInsertCasRx-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg2
Plasmid#124857PurposeMutagenesis of Gabrg2DepositorInsertGabrg2 (Gabrg2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin1
Plasmid#124852PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria1
Plasmid#124853PurposeMutagenesis of Gria1DepositorInsertGria1 (Gria1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-HA-mCherry-pA
Plasmid#233029PurposeTo Express HA Tagged hfCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInserthfCas13d-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231365PurposeminBG-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231366PurposePle155-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minCMVe-SCP1-SaCas9-W3SynpA
Plasmid#231370PurposeSCP1 promoter-driven SaCas9 with truncated CMV enhancer and short synthetic terminator sequence.DepositorInsertSaCas9
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria2
Plasmid#124854PurposeMutagenesis of Gria2DepositorInsertGria2 (Gria2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231364PurposePle155-driven mRuby2, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertmRuby2
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin2a
Plasmid#124850PurposeMutagenesis of Grin2aDepositorInsertGrin2a (Grin2a Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-NLS-AcrIIA4
Plasmid#113038PurposeAAV vector for expression of SV40NLS-AcrIIA4 in mammalian cells (CMV promoter driven)DepositorInsertSV40 NLS-AcrIIA4
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only