We narrowed to 11,185 results for: cat.1
-
Plasmid#113903PurposeHis-S tagged cytoplasmic catalytic domain 1 of Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 cytoplasmic catalytic domain 1 (ADCY6 Human)
TagsHis-SExpressionBacterial, Insect, and Mamm…PromoterT7, CMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1281)
Plasmid#192955PurposeFor membrane insertion study; Expresses tse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1281)
ExpressionBacterialMutationencodes for tse5 (1169-1281)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-838;+80pCalb2
Plasmid#66750Purposeluciferase reporter for Calb2 promoter (-838 to +80, WT)DepositorInsertCalb2 promoter (-838bp +80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT21
Plasmid#78102Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 2…PromoterT7Available SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT13
Plasmid#75087Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 4…Available SinceMay 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(WT)-mascRNA](pAVA2987)
Plasmid#239348PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
STIM1ct-ssrA2-mCerulean
Plasmid#223690PurposePhoBIT2 component; ssrA2 tag (ssrA mutant A2C) inserted into mCerulean-tagged STIM1 cytoplasmic domainDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC8
Plasmid#224343PurposeExpresses human KDAC8 (HDAC8) in insect cellsDepositorAvailable SinceFeb. 26, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc C1)
Plasmid#221273PurposeExpression of IRSp53 C-terminal truncation 1 (247-355) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc N1)
Plasmid#221272PurposeExpression of IRSp53 N-terminal truncation 1 (257-375) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 delta-SLD2
Plasmid#210263PurposeInducible expression of N-terminally EGFP-tagged NIP45 delta-SLD2. Use with Flp-In T-Rex system.DepositorInsertNIP45 delta-SLD2 (aa 1-343) (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationdelta-SLD2PromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1229)
Plasmid#192948PurposeFor membrane insertion study; expresses Tse5-CT (1169-1229)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1229)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1229)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1300)
Plasmid#192956PurposeFor membrane insertion study; Expresses tse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1300)
ExpressionBacterialMutationencodes for tse5 (1169-1300)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1317)
Plasmid#192957PurposeFor membrane insertion study; Expresses tse5-CT (1169-1317) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1317)
ExpressionBacterialMutationencodes for tse5 (1169-1317)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1269)
Plasmid#192954PurposeFor membrane insertion study; Expresses tse5-CT (1169-1269) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1269)
ExpressionBacterialMutationencodes for tse5 (1169-1269)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS238D1::sptse5-CT_phoA-lacZalpha
Plasmid#192961PurposeTest the biological function of the spTse5-CT (1169-1317)-PhoA (22-474)-LacZ (4-60) fusion protein in P. putidaDepositorInsertsptse5-CT_phoA-lacZ_
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1317) fused to phoA-lacZal…Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only