We narrowed to 4,407 results for: crispr c plasmids
-
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-miR122 TS
Plasmid#209783PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoter, incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)DepositorInsertmiR122 ts
UseAAVTagsHAPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PRINCE-SaCas9-2
Plasmid#250958PurposePRINCE drug inducible gene editing system based on SaCas9 (AAV-Part II : the expression of 2x ERT2 and the sgRNA is under drug-mediated control)DepositorInsertH1-TetO-SaCas9 sgRNA scaffold; EF1α-NpuC; 2×ERT2; opTtetR; GFP
UseAAV and CRISPRExpressionMammalianPromoterH1 promoter; EF1α promoterAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVPromotercTnTAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN
Plasmid#220128PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter, and add an HA tag fused to TadADepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVTagsHA tagPromoterMYL2Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TERTp124_Gluc_CCR5
Plasmid#192271PurposeDonor template for insertion of hTERT promoter (-124 C to T) driven Gaussia luciferase reporterDepositorInsertPromoter Reporter Insert within donor template
UseCRISPRMutation-124 C to TPromoterTERT promoter driving expression of gaussiaAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
TERTp146_Gluc_CCR5
Plasmid#192272PurposeDonor template for insertion of hTERT promoter (-146 C to T) driven Gaussia luciferase reporterDepositorInsertPromoter Reporter Insert within donor template
UseCRISPRMutation-146 C to TPromoterTERT promoter driving expression of gaussiaAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
hsLEMD2-pX330
Plasmid#179511PurposeEncodes gRNA for human LEMD2DepositorInsertgRNA for LEMD2
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 PPP2CA g1
Plasmid#170822PurposePiggyBac Cas13d sgRNA plasmid for PPP2CA knockdownDepositorInsertCas13d PPP2CA gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCM100_ PB5'IR-hU6-gRNA-CS1- CAG-tdTomato- PB3'IR
Plasmid#229995PurposePiggyBac sgRNA cloning plasmid with tdTomato reporter with a capture sequence (cs1)DepositorTypeEmpty backboneUseCRISPRTagsNotI site for NEBuilder HiFi DNA Assembly with ss…ExpressionMammalianPromoterCAGAvailable sinceFeb. 28, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only