We narrowed to 4,848 results for: pAAV
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-jGCaMP7c variant 1513
Plasmid#173159PurposeExpresses jGCaMP7c variant 1513 in astrocytesDepositorInsertjGCaMP7c variant 1513-WPRE
UseAAVTagsExpressionMutationPromoterGFAPAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
78_pAAV-ProA27-CatCh-GFP-WPRE
Plasmid#125910PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA27Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
45_pAAV-ProC10-CatCh-GFP-WPRE
Plasmid#125945PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC10Available sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pgk-DIO-rvCRY-WPRE
Plasmid#182060PurposePlasmids for production of AAV-based TFactivity reporterDepositorInsertmCherry
UseAAVTagsExpressionMutationPromoterhu Pgk1Available sinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV1-EF1α-F-Flex-jGCaMP7b-WPR
Plasmid#171689PurposeFlp-dependent expression of jGCaMP7bDepositorInsertGCaMP7b
UseAAVTagsExpressionMutationPromoterAvailable sinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1-S321A
Plasmid#115342PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321ADepositorInsertRIPK1 (Ripk1 Mouse)
UseAAVTagsFlagExpressionMammalianMutationS321APromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
193_pAAV-ProA35-CatCh-GFP-WPRE
Plasmid#125918PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA35Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
105_pAAV-ProC16-CatCh-GFP-WPRE
Plasmid#125951PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC16Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only