We narrowed to 4,447 results for: GCA
-
-
TTN gRNA (BRDN0001148405)
Plasmid#76852Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001146399)
Plasmid#76853Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-KIKO-U6-gTgfbr2-p2a-mCherry-STOPpA-400
Plasmid#249131Purposeall-in-one HDRT-based knockin-knockout (KIKO) design to insert mCherry (=knockin) at gTgfbr2 cut site, disrupting Osmr expression (=knockout)DepositorInsertgTgfbr2, mCherry (Tgfbr2 Mouse, Synthetic)
UseAAVAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-Puro
Plasmid#215362PurposeExpresses a rat Letm1 specific shRNADepositorInsertLetm1 shRNA Target sequence (Letm1 Rat)
UseLentiviralAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-mTagBFP2
Plasmid#215363PurposeExpresses a rat Letm1 specific shRNA and a BFP under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-miRFPnano
Plasmid#215365PurposeExpresses a rat Letm1 specific shRNA and miRFPnano under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-1
Plasmid#251685PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-CDK13(hU6-sg2-mU6-sg3)-Blast
Plasmid#208348PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK13DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
KHC064 pX335 BRD2 K1-1a
Plasmid#231711PurposeKHC064 (pX335 BRD2 K1-1a), gRNA and cas9D10A mammalian expression vector for CRISPR mediated cutting of BRD2 at the N-terminus, use with KHC065DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#1-puro
Plasmid#231984PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#2-puro
Plasmid#231983PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgMST1/2-1
Plasmid#229429Purposeknockout of MST1 and MST2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3
Plasmid#227801PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA3DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R2187A
Plasmid#169827PurposeExpresses C-terminal flag-tagged CAD with mutation at reported trimerization interface of the ATCase domain of CADDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationR2187A, T456A S1406A S1859A; TCCC -> AGTC sile…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only
