We narrowed to 3,219 results for: cat.3
-
-
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BCL11B-E1(14))-PGKpuro2ABFP-W
Plasmid#208554PurposeLentiviral vector expressing gRNA targeting human BCL11B-E1DepositorInsertBCL11B-E1(14) (BCL11B Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
mRFP-FKBP-INPP5E(D556A)
Plasmid#183678PurposeRecruitable human type IV 5-phosphatase enzyme (catalytically inactive)DepositorInsertINPP5E (INPP5E Human)
TagsmRFP-FKBP12(1-108)ExpressionMammalianMutationC641A, D556APromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pABD1275
Plasmid#68017PurposePIF1 protein overproduction for purification from bacterial cellsDepositorInsertPHY-INTERACTING FACTOR 1 (PIF1) (PIL5 AT2G20180, Mustard Weed)
Tags6x-HisExpressionBacterialMutationCodon Optimized for bacterial expression (GenScri…PromoterT7Available SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BCL11B-E1(13))-PGKpuro2ABFP-W
Plasmid#212116PurposeLentiviral vector expressing gRNA targeting human BCL11B-E1DepositorInsertBCL11B-E1(13) (BCL11B Human)
UseLentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-S580X
Plasmid#195474PurposepInducer21 plasmid containing the human MEFV gene with the S580X mutation (stop codon leading to the truncation of the B30.2 domain of the pyrin protein) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged S580 to a stop codonAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3E-SGTAP no-pA
Plasmid#82599Purpose3' entry vector containing streptavidin binding protein (SBP) followed by a TEV cleavage site and 2 protein G copies without pA for tandem affinity purificationDepositorInsertSBP-TEV-2x protein G
PromoterNoneAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-JEDI-1P
Plasmid#202618PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P under the promoter hsp70 for Drosophila (insect) expressionDepositorInsertJEDI-1P
ExpressionInsectPromoterhsp70Available SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only
