We narrowed to 6,199 results for: 338
-
Plasmid#75619Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK15DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MAPK15 gRNA (BRDN0001162376)
Plasmid#75620Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK15DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK15 gRNA (BRDN0001162374)
Plasmid#75621Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK15DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK11B gRNA (BRDN0001146011)
Plasmid#77065Purpose3rd generation lentiviral gRNA plasmid targeting human CDK11BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK11B gRNA (BRDN0001146017)
Plasmid#77066Purpose3rd generation lentiviral gRNA plasmid targeting human CDK11BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK7 gRNA (BRDN0001148313)
Plasmid#76894Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK7 gRNA (BRDN0001145201)
Plasmid#76895Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK7 gRNA (BRDN0001145053)
Plasmid#76896Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP3K9 gRNA (BRDN0001146157)
Plasmid#77309Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1D gRNA (BRDN0001149348)
Plasmid#76716Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-HK2 (D209A, D657A)-3xFLAG
Plasmid#239244PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterCMVAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCW-Rho(G14V)-HA
Plasmid#247437PurposeHA-tagged human RhoA(G14V) cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianMutationG14V mutation (constitutive active mutant)Available SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Pgc-1alpha-EYFP
Plasmid#241793PurposeExpression vector for mouse Pgc-1alpha with EYFPDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_H0-ABD+
Plasmid#234554PurposeCTNNA1 M-domain deletion mutant with enhanced actin-binding domain mutationsDepositorAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 puro HTRA2 sg2
Plasmid#244864PurposeKnockout of human HTRA2DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 puro HTRA2 sg1
Plasmid#244863PurposeKnockout of human HTRA2DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4308 IL-10Rb NTEVp chain (human IgG VH SS) in PolyTX-mNeonGreen
Plasmid#244169PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hIgGVHSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human IgG-VH SS, human IL-10Rb ECD and TMD, and NTEVp 75S mutant (IL10RB Human, Synthetic)
UseSynthetic BiologyTagshuman IgG VH signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4312 IL-10Rb NTEVp chain (human CD8a SS) in PolyTX-mNeonGreen
Plasmid#244170PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hCD8aSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human CD8a SS, human IL-10Rb ECD and TMD, and NTEVp (75S) (IL10RB Human, Synthetic)
UseSynthetic BiologyTagshuman CD8a signal peptide 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only