We narrowed to 1,631 results for: PTS;
-
Plasmid#62894PurposeTrojan-Gal4 Expression Module in Phase 2. Insert T2A-Gal4 to genomic loci using the Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorTypeEmpty backboneAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pT-GEM(0)
Plasmid#62891PurposeTrojan-Gal4 Expression Module in Phase 0. Insert T2A-Gal4 to genomic loci using the Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorTypeEmpty backboneAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT-GEM(1)
Plasmid#62893PurposeTrojan-Gal4 Expression Module in Phase 1. Insert T2A-Gal4 to genomic loci using the Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorTypeEmpty backboneAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pART (pT-2)
Plasmid#62708PurposeMammalian expression of tdTomato from the broadly active CAG promoter/enhancerDepositorInserttdTomato
ExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAQI (pT-1)
Plasmid#62707PurposeMammalian expression of tdTomato from the broadly active CAG promoter/enhancerDepositorInserttdTomato
ExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pt NaV1.4-N1600T
Plasmid#200289PurposeExpression in mammalian cells or oocytesDepositorInsertPhyllobates terriblis NaV1.4 – muscle channel
ExpressionMammalianMutationN1600TPromoterCMV and T7Available SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS117 His14-Avi-45xGS-anti GFP nanobody
Plasmid#199370PurposeBacterial expression plasmid for anti-GFP nanobody with an N-terminal His-tag and biotin acceptor peptide (Avi)DepositorInsertanti-GFP nanobody
Tags14xHis-AviExpressionBacterialMutationWTPromoterT5-LacOAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS96 pHAGE2 CMVtetO2 GFP-22xGS-SUMOEu-MCS
Plasmid#199349PurposeLentiviral transfer plasmid for doxycycline inducible expression of a N-terminally GFP-SUMOEu-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsEGFP-SUMOEuExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only