We narrowed to 1,334 results for: 5-Oct
-
Plasmid#67496PurposeExpression of shRNA targeting human ARF3bDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only
-
-
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EK0544 CMV-TO-mCherry-SG(s70587-dblstop)SG-EGFP (FLP-IN)
Plasmid#191176PurposeMammalian expression of EK0209 with a second stop codon.DepositorInsertCMV-TO:mCherry:s70587:EGFP (double-stop)
ExpressionMammalianMutationadditional stop codonPromoterCMV-TOAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
EK0546 SFFV-mCherry-SGc(GAPDH.s1-dblstop)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#191178PurposeMammalian expression of EK0493 with second stop codon.DepositorInsertmCherry:GAPDH.s1:EGFP (double-stop)
ExpressionMammalianMutationadditional stop codonPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
EK0494 SFFV-mCherry-SGc(CFL1.s1)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#191181PurposeExpression of CFL1 sensor in mammalian cellsDepositorInsertmCherry:CFL1.s1:EGFP-3xMS2
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
EK0290 SFFV-mCherry-SG(s70587-AND-s17d9b)SG-EGFP (FLP-IN)
Plasmid#191143PurposeExpression of Sensor for (1 AND 2) "EK0208 AND EK0211" in mammalian cells; mCherry marker, EGFP output.DepositorInsertmCherry:s70587-AND-s17d9b:EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
EK0312 pAAV-EF1a-DIO-EYFP-WPRE-HGHpA
Plasmid#191148PurposeAAV expression of a Cre reporter with EYFP outputDepositorInsertDIO-EYFP
UseAAVExpressionMammalianMutationWTPromoterhEF1aAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
EK0341 SFFV-mCherry-SG(Bdnf.s1L153)SG-EGFP (FLP-IN)
Plasmid#191150PurposeExpression of a 153 bp long sensor for murine Bdnf 3' UTR in mammalian cellsDepositorInsertmCherry:Bdnf.s1L153:EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
EK0358 SFFV-mCherry-SG(Bdnf.s1L36)SG-EGFP (FLP-IN)
Plasmid#191152PurposeExpression of a 36 bp long sensor for murine Bdnf 3' UTR in mammalian cellsDepositorInsertmCherry:Bdnf.s1L36:EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Stx5L-mCherry
Plasmid#209844PurposeExpresses Stx5L-mCherry in mammalian cellsDepositorInsertSTX5 (STX5 Human)
TagsmCherryExpressionMammalianMutationWildtype Stx5 (with 55M)PromoterCMVAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
MLM3743
Plasmid#49962PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-5 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3727
Plasmid#49961PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
JA1246
Plasmid#49960PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
hs-leonardo
Plasmid#42065DepositorAvailable SinceFeb. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRegev_V2
Plasmid#204144PurposeSingle reporter randomly selected from splicing library for biochemical validation.DepositorInsertV2 exon in beta globin splicing minigene
UseSynthetic BiologyExpressionMammalianPromoterTruncated CAGAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRegev_V3
Plasmid#204145PurposeSingle reporter randomly selected from splicing library for biochemical validationDepositorInsertV3 exon in beta globin splicing minigene
UseSynthetic BiologyExpressionMammalianPromoterTruncated CAGAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only