We narrowed to 676 results for: ADH1;
-
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-mVenus-FLAG-LANS1-Set2
Plasmid#122003PurposemVenus-FLAG-LANS-Set2: mVenus- and FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInsertmVenus-FLAG-LANS1-Set2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsmVenus-FLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ3A
Plasmid#197513PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-3 σ3A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-3 σ3A
TagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationsilent substitution in codon 2 of tyrosinase tail…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-FLAG-LANS1-Set2
Plasmid#122002PurposeFLAG-LANS-Set2: FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInserthistone methyltransferase SET2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsFLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH748-CEN-RLuc/min8maxCFLuc
Plasmid#38214DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first eight codons of the original FLuc gene …PromoterADH1 and TDH3 (=GDP)Available SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH731-2µ-RLuc/minCFLuc
Plasmid#40601DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH747-CEN-RLuc/min4maxCFLuc
Plasmid#38213DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first four codons of the original FLuc gene w…PromoterADH1 and TDH3 (=GDP)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
P2802
Plasmid#248828PurposeAll repressors for the WTC847 system.DepositorInsertLexA-L7-hER(L387M), LexA-hER-adh1tail
ExpressionYeastMutationLexA-L7-hER: L387MPromoterpACT1 (LexA-L7-hER(L387M)), P7SulA.1(LexA-hER-adh…Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pVG50
Plasmid#164708PurposeyEVenus under the control of tetOpr with ADH1t upstream of the reporterDepositorInsertADH1t - tetOpr - yEVenus - CLN2 PEST - ADH1t
ExpressionYeastAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMM0281
Plasmid#128972PurposeEncodes VP16-CIB1 under pADH1 promoterDepositorInsertpscADH1-SV40NLS-VP16-CIB1-tscADH1
ExpressionYeastAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
EZ-L767
Plasmid#131773PurposePADH1_sFUS_Fusion Red_PixD_TACT1DepositorInsertPADH1_sFUS_Fusion Red_PixD_TACT1
UseIntegration into δ-sitesExpressionYeastPromoterPADH1Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM0320
Plasmid#128980PurposeEncodes Zif268DBD-CRY2PHR under pscADH1DepositorInsertpscADH1-SV40NLS-ZIF268DBD-CRY2PHR (L3)-tscADH1 TRP1
ExpressionYeastAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNS3
Plasmid#131770PurposePADH1_FUSN_Fusion Red_Cry2Olig_TACT1 for Integration into δ-sitesDepositorInsertPADH1_FUSN_Fusion Red_Cry2Olig_TACT1
UseIntegration into δ-sitesExpressionYeastMutationE490G to make Cry2 into Cry2OligPromoterPADH1Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-24d-Flag-SKP1
Plasmid#213690PurposeExpresses human SKP1 in bacteria cellsDepositorAvailable SinceFeb. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-SKP1-T131A
Plasmid#213482PurposeExpresses human SKP1 T131A mutant in mammalian cellsDepositorAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only