We narrowed to 893 results for: gcat
-
Plasmid#90746Purpose3rd generation lentiviral gRNA plasmid targeting human MAPRE1DepositorInsertMAPRE1 (Guide Designation F9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTPS1 E11.3 gRNA
Plasmid#90644Purpose3rd generation lentiviral gRNA plasmid targeting human CTPS1DepositorInsertCTPS1 (Guide Designation E11.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
SRSF2 A9.3 gRNA
Plasmid#90902Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
SGO1 H2.1 gRNA
Plasmid#90887Purpose3rd generation lentiviral gRNA plasmid targeting human SGO1DepositorInsertSGO1 (Guide Designation H2.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
HJURP E4.1 gRNA
Plasmid#90711Purpose3rd generation lentiviral gRNA plasmid targeting human HJURPDepositorInsertHJURP (Guide Designation E4.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001148301)
Plasmid#77888Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRRAP gRNA (BRDN0001144900)
Plasmid#76537Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HSPB8 gRNA (BRDN0001145453)
Plasmid#75640Purpose3rd generation lentiviral gRNA plasmid targeting human HSPB8DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan-ADE2
Plasmid#232105PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
NFATc3-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124288PurposesgRNA against human NFATc3DepositorInsertNFATc3 nuclear factor of activated T cells (NFATC3 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
IKBKB gRNA (BRDN0001145579)
Plasmid#76090Purpose3rd generation lentiviral gRNA plasmid targeting human IKBKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide3
Plasmid#118175PurposeCRISPR-mediated repression of GLIS3. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(WT)-mRuby2
Plasmid#215446PurposeGateway entry vector with integrin beta1 tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway CloningTagsmRuby2MutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR C2CD4AB-enh3-guide3
Plasmid#125410PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs17205526 (C2CD4A/B GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTJK459
Plasmid#138008PurposeEmpty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorTypeEmpty backboneUseLentiviralMutationU-A flip and hairpin extension: cgtttAagagctaTGCT…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ OBfold
Plasmid#126901PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ OBfold
Plasmid#126889PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only