We narrowed to 6,531 results for: nls
-
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-evoBxb1
Plasmid#232747PurposeIVT template for making modRNA encoding evoBxb1DepositorInsertBxb1
UseIn vitro transcriptionTagsHA and SV40 NLSMutationV74AAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sga-Cas9
Plasmid#227005PurposeMammalian expression of Nuclease active S. gallolyticus Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sin-Cas9
Plasmid#227006PurposeMammalian expression of Nuclease active S. iniae Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Spa-Cas9
Plasmid#227007PurposeMammalian expression of Nuclease active S. parasanguinis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sub-Cas9
Plasmid#227008PurposeMammalian expression of Nuclease active S. uberis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-Cas9-FCPF
Plasmid#220132PurposeExpresses Cas9-FCPF in E.coliDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-KRAB-2A-mTurquoise
Plasmid#225690PurposeLentiviral expression of rTetR(SE) fused to ZNF10 KRAB and mTurquoise-NLSDepositorInsertrTetR-ZNF10 KRAB
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3668
Plasmid#215243PurposeTU for the expression of mAID (N-tag): AcrIIA4 w/o NLS protein Codon optimized for N. benthamiana expression under the regulation of the 35S promoter and TNOS terminatorDepositorInsertP35S:mAID:AcrIIA4:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB1531
Plasmid#215242PurposeTU for constitutive expression of Streptomyces phage phiC31 integrase. Catalyzes site-specific recombination between phiC31 attB and attP sites. Contains SV40 NLS. N. benthamiana codon optimized.DepositorInsertPNos:PhiC31:TNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL390
Plasmid#219500PurposeIntegrating inducible cassette (Cas9-P2A-Csy4 and Eco1 RT) for yeast overexpressionDepositorInsertIntegrating inducible cassette: Cas9-P2A-Csy4 and Eco1 RT
TagsSV40-NLSExpressionYeastPromoterGAL1-GAL10Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only