We narrowed to 4,490 results for: Gca
-
Plasmid#105592Purposelentivirally express gRNA targeting human MYB DBD with GFP marker and neo resistanceDepositorInsertgRNA targeting human MYB DBD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
NDUFAB1 C3.3 gRNA
Plasmid#90791Purpose3rd generation lentiviral gRNA plasmid targeting human NDUFAB1DepositorAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
AK9 gRNA (BRDN0001146911)
Plasmid#77689Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AK9 gRNA (BRDN0001147860)
Plasmid#77692Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYLK gRNA (BRDN0001147034)
Plasmid#77022Purpose3rd generation lentiviral gRNA plasmid targeting human MYLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CALM3 gRNA (BRDN0001149124)
Plasmid#76888Purpose3rd generation lentiviral gRNA plasmid targeting human CALM3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CALM3 gRNA (BRDN0001149161)
Plasmid#76889Purpose3rd generation lentiviral gRNA plasmid targeting human CALM3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TGFBR1 gRNA (BRDN0001145243)
Plasmid#76645Purpose3rd generation lentiviral gRNA plasmid targeting human TGFBR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CALM1 gRNA (BRDN0001145447)
Plasmid#75761Purpose3rd generation lentiviral gRNA plasmid targeting human CALM1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME1 gRNA (BRDN0001146284)
Plasmid#75539Purpose3rd generation lentiviral gRNA plasmid targeting human NME1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsynapsin-DIO-adra2a-shRNA-mCherry
Plasmid#245063PurposeAAV-transgene knocking down adra2a receptor (adrenergic 2a receptor) transcripts cell type-selectively. Using the pPRIME. system, this generates mir30-derived shRNAs and a marker from the same RNA.DepositorInsertAAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry (Adra2a Synthetic, Mouse)
UseAAV, Cre/Lox, and RNAiPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced-MUT- deltaACAbox
Plasmid#242753PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced-MUT- deltaHbox
Plasmid#242752PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1 unspliced-MUT- deltaSNORA13
Plasmid#242751PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210744PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200506PurposeLentiviral vector expressing gRNA targeting human ARID1A and AAVS1DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210742PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 2DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 2
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only