We narrowed to 4,467 results for: Erf
-
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K197R-VA
Plasmid#191223PurposeLentiviral expression of human IFIT5_K197R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationchanged Lysine 197 to Arginine (K197R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_WT-VA
Plasmid#191221PurposeLentiviral expression of human IFIT5_WT in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianPromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K160R-VA
Plasmid#191222PurposeLentiviral expression of human IFIT5_K160R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationchanged Lysine 160 to Arginine (K160R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Synthetic, Human)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPm-IFNAR1(28-557)
Plasmid#192704PurposeExpression of SNAPf and mEGFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPm…ExpressionMammalianMutationmeGFPm: gluatmic acid 142 to asparagine and histi…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPm-IFNAR1(28-557)
Plasmid#192784PurposeExpression of SNAPf and mXFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2 NCmut-msfGFP_SEPT6
Plasmid#180312Purposebacterial co-expression of human SEPT2 NCmut fused to monomeric superfolder GFP and of human SEPT6DepositorTagsHis6-TEV and msfGFPExpressionBacterialMutationSEPT2 F20D, V27DAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE1 (minus strand)
Plasmid#91842PurposeLuciferase reporter for CD69 enhancer (IGI-P0619)DepositorInsertCD69 CaRE1 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (plus strand)
Plasmid#91848PurposeLuciferase reporter for CD69 enhancer (IGI-P0625)DepositorInsertCD69 CaRE2 (plus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (minus strand)
Plasmid#91843PurposeLuciferase reporter for CD69 enhancer (IGI-P0620)DepositorInsertCD69 CaRE2 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4s-NGR-WPRE
Plasmid#234441PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas ServiceAAV1InsertiGluSnFR4s-NGR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-NGR-WPRE
Plasmid#234437PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas ServiceAAV1InsertiGluSnFR4s-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-NGR-WPRE
Plasmid#234438PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas ServiceAAV1InsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4f-PDGFR-WPRE
Plasmid#234446PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4s-NGR-WPRE
Plasmid#234451PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4f-NGR-WPRE
Plasmid#234452PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only