We narrowed to 4,564 results for: HRE
-
Plasmid#114856PurposePrey vector RKF1 X030_pECIA14 should be used with bait vector RKF1 X030_pECIA2.DepositorInsertAT1G29750 (RKF1 Mustard Weed)
UseTagsExpressionInsectMutationPromoterMetallothionein (Copper-Inducible)Available sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 A82V/T230A/D637G 2014 EBOV Delta-Mucin-Like-Domain
Plasmid#86026PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
UseTagsExpressionMammalianMutationLacks mucin-like domain; Changed alanine 82 to va…PromoterCMV IEAvailable sinceJuly 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_WT&Mut-SM
Plasmid#215916PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_WT&Mut (BRAF Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_WT-SM
Plasmid#215917PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ WT (BRAF Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_Mut1-SM
Plasmid#215918PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ Mut1 (BRAF Human)
UseTagsExpressionMammalianMutationBRAFPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_Mut2-SM
Plasmid#215919PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ Mut2 (BRAF Human)
UseTagsExpressionMammalianMutationBRAFPromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177344PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from doxycycine-inducible promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterTetracycline-dependent promotersAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
CamKII-LGI1-T380A-pHluorin
Plasmid#185543PurposeExpresses mutant T380A LGI1-pHluorin under the CamKII promoterDepositorInsertLGI1 (Lgi1 Rat)
UseLentiviralTagspHluorinExpressionMammalianMutationchanged threonine 380 for alaninePromoterCamKIIAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe 3XFLAG-S/T3A-GATA6-3XAU1 puro
Plasmid#72611PurposeFor mammalian expression of an N-terminally triple FLAG-tagged and C-terminally triple AU1-tagged full length human GATA6 with triple alanine mutations on aminoacids#33,#34 and #37DepositorInsertGATA binding protein 6 (GATA6 Human)
UseRetroviralTags3XAU1 and 3XFLAGExpressionMammalianMutationchanged serine33, threonine34 and serine37 to ala…PromoterAvailable sinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH748-CEN-RLuc/min8maxCFLuc
Plasmid#38214DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first eight codons of the original FLuc gene …PromoterADH1 and TDH3 (=GDP)Available sinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH753-CEN-RLuc/min346maxCFLuc
Plasmid#38219DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 346 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH747-CEN-RLuc/min4maxCFLuc
Plasmid#38213DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first four codons of the original FLuc gene w…PromoterADH1 and TDH3 (=GDP)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti-LucA
Plasmid#174047PurposeExpresses mALG8 (ITYTWTRL) antigen as a fusion to luciferase and Cre recombinaseDepositorInsertLucA
UseCre/Lox, Lentiviral, and LuciferaseTagsLuciferaseExpressionMammalianMutationALG8 alanine 506 to threoninePromoterHuman Ubiquitin CAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pCX-OKS-2A
Plasmid#19771PurposeNon-integrating (episomal) expression of mouse Oct3/4, Klf4 and Sox2DepositorUseTagsExpressionMammalianMutationThree genes are connected with the foot-and-mouth…PromoterAvailable sinceJan. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-STK32C
Plasmid#23720DepositorInsertSTK32C (STK32C Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pC0054-CMV-dPspCas13b-longlinker-ADAR2DD(E488Q/T375G)
Plasmid#103870PurposeHigh specificity version of dPspCas13b-ADAR2DD(E488Q) fusions. T375G mutation in the ADAR deaminase domain confers increased specificity with slightly reduced activity.DepositorInsertsUseCRISPRTagsGSGGGGS and HIV NESExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only