We narrowed to 57,800 results for: plasmid
-
Plasmid#165146PurposeBait plasmid for PROBER (empty backbone encoding replaceable ccdB cassette)DepositorTypeEmpty backboneUseUnspecifiedAvailable sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pGEM4Z-EGFP
Plasmid#183475PurposeThis plasmid can be used to prepare EGFP mRNA by In Vitro TranscriptionDepositorInsertEGFP
ExpressionBacterialPromoterT7Available sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE reporter backbone
Plasmid#158678PurposeThis plasmid serves as the backbone for the TRE reporters described in our paper. It's a promoterless-mStrawberry-pGK-BSD backbone to which we insert a pathway specific promoter before the mStrawberryDepositorTypeEmpty backboneUseLentiviralTagsmStrawberryExpressionMammalianAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6-petRNA
Plasmid#181802PurposepetRNA cloning plasmidDepositorInsertpetRNA-Kan
UseCRISPRAvailable sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMB1_MmPylRS_MmtRNA-Pyl-opt(UGA)
Plasmid#174515PurposeRecoded single aaRS/tRNA plasmid with MmPylRS and MmtRNA-Pyl-opt with the ASL from the serT gene (UGA anticodon)DepositorInsertsMm PylS
MmtRNA-Pyl-opt(UGA)
ExpressionBacterialMutationASL from the serT gene (UGA anticodon) and recodedPromoterGlnS and lppAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Puro-miniAAVR-FLAG
Plasmid#166717PurposeVector expressing a minimal AAVR (KIAA0319L) construct PKD1-3 with a C-terminal Flag tagDepositorInsertminiAAVR-FLAG
UseLentiviralTagsFLAGExpressionMammalianMutationOnly expressing PKD1-3 of ectodomainPromoterCMVAvailable sinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaTCH_empty-backbone
Plasmid#157746PurposeLentiviral CaTCH barcoding plasmid harboring an emtpy cloning site to insert a CaTCH barcoding library or individual barcode sequencesDepositorTypeEmpty backboneUseLentiviral; Catch barcode cloningExpressionMammalianAvailable sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Intron-Tagging-EGFP-Donor
Plasmid#159740PurposeContains EGFP flanked by a splice acceptor and a splice donor. Together with other intron tagging plasmids, it can be used to place the EGFP tag as a synthetic exon into introns of target genes.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEGFP
UseIntron tagging donorAvailable sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJJiaDEST-APEX2
Plasmid#149517PurposeN-termial APEX2 tag. Gateway destination vector for mammanlian expressionDepositorTypeEmpty backboneTagsFLAG-APEX2ExpressionMammalianPromoterCMVAvailable sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET51b(+)_ALFA-tag-SNAP
Plasmid#136628PurposePlasmid encoding the bacterial expression of ALFA-tag asa SNAP-tag fusionDepositorInsertEGFP-NbALFA
TagsHisx10 and StrepExpressionBacterialPromoterT7Available sinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
HR180-LGR5-CreER
Plasmid#129093PurposeKI CreER with a puromycin/mRuby selection cassette into human LGR5 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCreERT2 and LGR5 homology arms (LGR5 Human)
UseHomologous recombination donor plasmidAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FRP2365
Plasmid#127575PurposeRepressor plasmid for WTC 846. Encodes TetR and TetR-Tup1, Ura3 selection markerDepositorInsertPRnr2_TetR-NLS-TUP1_tCyc1_PtetO7.1_TetR-NLS_tCyc1
UseSynthetic Biology; Shuttle vectorExpressionYeastAvailable sinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
amilGFP chromoprotein
Plasmid#117842PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses amilGFP chromoprotein in E. coliDepositorInsertpromoter, RBS, amilGFP
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable sinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
epB_CAG_TetRFlag-nls-tdTom_DEx4
Plasmid#119909PurposeePiggyBac mammalian expression plasmid for TetR-tdTom fusionDepositorInsertTetRFlag-nls-tdTom
ExpressionMammalianAvailable sinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGT-Ah1
Plasmid#122568PurposeMAGIC donor plasmid (Himar transposon with beta-lactamase/sfGFP payload)DepositorInsertbeta-lactamase/sfGFP
UseSynthetic BiologyExpressionBacterialAvailable sinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgAAVS1
Plasmid#85802PurposeCas9/CRISPR vector for cut at human AAVS1 gene intron1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPPP1R12C (PPP1R12C Human)
ExpressionMammalianAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC1181 - pmU6(loxP-STOP-loxP) BbsI gRNA
Plasmid#113160PurposeA plasmid for cloning Cre-dependent guide RNAs using a modified mouse U6 promoter containing loxPDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromotermU6Available sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRK5-HA-Ubiquitin-K6
Plasmid#121151PurposeMammalian expression of HA tagged ubiquitin with K6 only, other lysines mutated to argininesDepositorAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by