We narrowed to 225 results for: Blasticidin-encoding lentiviral vector
-
Plasmid#176291PurposeGateway vector for use in generating POI-DCK* fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable sinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-GW-IRES-GFP
Plasmid#176289PurposeGateway vector for use in generating DCK*-POI fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable sinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only