We narrowed to 65,344 results for: %s

#174298

Encodes the SARS-CoV-2 Spike Receptor Binding Domain (RBD) with the E484K mutation and can be combined with pJS697 (Addgene plasmid # 168778) through homologous recombination

Timothy Whitehead

Francino-Urdaniz et al Cell Rep. 2021 Aug 31;36(9):109627. doi:

Sept. 10, 2021

Academic Institutions and Nonprofits only

#143093

Lentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.

Feng Zhang

Joung et al Cell. 2023 Jan 5;186(1):209-229.e26. doi

June 27, 2023

Academic Institutions and Nonprofits only

#175261

labelling of microtubule plus end and F-actin structures

Frank Bradke, Sebastián Dupraz

Alfadil et al J Vis Exp. 2021 Oct 14;(176). doi: 10.37

Oct. 5, 2022

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#77980

3rd generation lentiviral gRNA plasmid targeting human PGK1

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#52265

Bacterial expression of GST-tagged TARGET proteins fused to SUMO-E2 with GyrA intein linker

Primo Schaer

Weber et al PLoS One. 2014 Jul 9;9(7):e102157. doi:

July 10, 2014

Academic Institutions and Nonprofits only

#236274

Bacterial expression of bovine arrestin-1 C63A, C128S, C143A, inserted GGT codon after starting ATG

Vsevolod Gurevich

Hanson et al Proc Natl Acad Sci U S A. 2006 Mar 28;10

May 15, 2025

Academic Institutions and Nonprofits only

1 Article

#251257

To express the SARS-CoV-2 (Wuhan) receptor binding domain with a nine-arginine tag at the C-terminus in E. coli

Yutaka Kuroda

Brindha et al Int J Mol Sci. 2022 Feb 1;23(3):1703. do

April 29, 2026

Academic Institutions and Nonprofits only

#252983

Encodes MYC-tagged S. cerevisiae Aga1 del N181aa disp anchor as a Type 4a part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)

Paul Young

Juric et al ACS Synth Biol. 2026 Apr 23. doi: 10.102

April 22, 2026

Academic Institutions and Nonprofits only

#249233

PTPRS CRISPR KO

Weihong Tan

Luo et al Science. 2026 Jan;391(6780):eadv6127. do

Feb. 11, 2026

Academic Institutions and Nonprofits only