We narrowed to 64,328 results for: %s
-
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001487049)
Plasmid#77981Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001146969)
Plasmid#77982Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NG1237 pCI-TPI-PTC160-4H
Plasmid#65804PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianMutationpremature stop codon at 160PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521-myc
Plasmid#196239PurposeN-terminal GST fusion of Af1521(WT) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(WT) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRZ241:SSX1p-GAD-EX1-5'D-ID-BD6-S(50bp)
Plasmid#251319PurposeExpression of GAD-EX1 under SSX1p promoter for use in synthetic gene circuitsDepositorInsertGAD-EX1
ExpressionMammalianPromoterSSX1pAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ274:SSX1p-mK2-Ex1-ID-AFP BD-S-(linker1)-pA
Plasmid#251321PurposeExpression of mK2-Ex1 under SSX1p promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex1
ExpressionMammalianPromoterSSX1pAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28c_S(-31)-M30_dT7term
Plasmid#112253PurposeExpresses the S(-31)-M30 apta-FRET RNA origami structure.DepositorInsertS(-31)-M30 apta-FRET RNA origami with T7 promoter and terminators.
UseSynthetic BiologyExpressionBacterialPromoterT7 promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28c_S*5-M5_dT7term
Plasmid#112254PurposeExpresses the S*5-M5 apta-FRET RNA origami structure.DepositorInsertS*5-M5 apta-FRET RNA origami with T7 promoter and terminators.
UseSynthetic BiologyExpressionBacterialPromoterT7 promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-hSyn-Galpha-s-IRESWT-Gbetagamma ONE-GO
Plasmid#204342PurposeGPCR/G protein BRET biosensorDepositorInserthSyn Galpha-s/Gbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLN552 (FuGW-S(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe)
Plasmid#105202PurposeModule 1 - synthetic promoter USF1 drives self-inhibiting GAD expression (see PMID: 29056342 for detailed information)DepositorInsertS(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
mPA-GFP-ER-3
Plasmid#57131PurposeLocalization: Endoplasmic Reticulum, Excitation: 400 / 504, Emission: 515 / 517DepositorAvailable SinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223-CDC2
Plasmid#23776DepositorInsertCDC2 (CDK1 Human)
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-BD-SARS-CoV-2-S-tail-WT
Plasmid#218455PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying an N-terminal GST-tag (S SARS-CoV-2)
TagsGSTExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TKT
Plasmid#39182PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-HsAIDSc
Plasmid#60810Purposeto express human AID recoded for yeast codon usageDepositorAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Calreticulin-C-10
Plasmid#54022PurposeLocalization: Endoplasmic Reticulum, Excitation: 487, Emission: 509DepositorAvailable SinceJuly 2, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDNA3.1-spikeRBD::∆ACE2 SURF
Plasmid#206957PurposeFluorescent reporter of the interaction between SARS-CoV-2 spike and human ACE2DepositorTagscSURF, mCherry, and nSURFExpressionMammalianMutation17-615 and RBD (319-541)PromoterCMVAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only