We narrowed to 7,458 results for: Ank
-
Plasmid#245063PurposeAAV-transgene knocking down adra2a receptor (adrenergic 2a receptor) transcripts cell type-selectively. Using the pPRIME. system, this generates mir30-derived shRNAs and a marker from the same RNA.DepositorInsertAAV-human synapsin promoter-DIO-adra2a-shRNA-mCherry (Adra2a Mouse, Synthetic)
UseAAV, Cre/Lox, and RNAiPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Neo-CMV>hCCNL2
Plasmid#239219PurposeExpresses CCNL2 in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B
Plasmid#239211PurposeExpresses CDK11B in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11A G567S
Plasmid#239214PurposeExpresses CDK11A with G567S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11A with G567S resistance mutation (CDK11A Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 567 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.1
Plasmid#222473PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 1). Variant 1 is chr10:128568698-A-G where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 1) (LOC110120928 Human)
UseLuciferaseMutationVariant 1 is chr10:128568698-A-G where the inform…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock1-I436C+S993C
Plasmid#182879PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Serine 993…Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock2-I436C+T1051C
Plasmid#182880PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Threonine …Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
DRH016_ AAV-hSyn-DN-THR
Plasmid#225089PurposeExpression of dominant-negative thyroid receptor beta (THRB, human) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertDN-THRB (THRB Human)
UseAAVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseMutationVariant 3 is chr10:128569437-G-A where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.2
Plasmid#222474PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 2). Variant 2 is chr10:128569418-T-C where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 2) (LOC110120928 Human)
UseLuciferaseMutationVariant 2 is chr10:128569418-T-C where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 R9H res
Plasmid#214753Purposeexpresses human MR1 R9H resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-R121A/K334A/R440A
Plasmid#193366Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationR121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA …PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-FRB-MCU-Flag-TetOFF
Plasmid#185659PurposeTet/dox-repressible expression of N-terminus FRB tagged human mitochondrial calcium uniporter with C-terminus Flag epitopeDepositorInsertMitochondrial calcium uniporter (MCU Human)
UseLentiviralTagsFRB and FlagExpressionMammalianPromoterpTight TREAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-BPNLS(SV40)-P2A-EGFP (LTH1378)
Plasmid#185484PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS, C-terminal bi-partite NLS, and P2A-eGFPDepositorInserthuman codon usage NLS-anCas(SCA)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-P2A-eGFP and NLSExpressionMammalianPromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-BPNLS(SV40)-P2A-EGFP (LTH1441)
Plasmid#185486PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS, C-terminal bi-partite NLS, and P2A-eGFPDepositorInserthuman codon usage NLS-anCas(PCA)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-P2A-eGFP and NLSExpressionMammalianPromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(FCA)-BPNLS(SV40)-P2A-EGFP (LTH1380)
Plasmid#185487PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS, C-terminal bi-partite NLS, and P2A-eGFPDepositorInserthuman codon usage NLS-anCas(FCA)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-P2A-eGFP and NLSExpressionMammalianPromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only