We narrowed to 41,676 results for: Ina
-
Plasmid#17800DepositorInsertErbB4 (ERBB4 Human)
UseTagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …PromoterAvailable sinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBS-germinal histone H4
Plasmid#26600DepositorInsertgerminal histone H4
UseTagsExpressionMutationPromoterAvailable sinceFeb. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Halo XRCC4
Plasmid#207541PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous XRCC4 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human XRCC4 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-Ku70
Plasmid#207547PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous Ku70 locus.DepositorInsertHaloTag with flanked by human Ku70 locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactiveEmpty
Plasmid#213168PurposeEmpty Vector (no sgRNA) used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterE1Fa and U6Available sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only