We narrowed to 12,069 results for: shRNA
-
Plasmid#244933PurposeCRISPR gRNA targeting the C-terminal end of Torso for cleavage.DepositorInsertgRNA targeting Torso C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Btl
Plasmid#244934PurposeCRISPR gRNA targeting the C-terminal end of Breathless for cleavage.DepositorInsertgRNA targeting Btl C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-EGFR
Plasmid#244932PurposeCRISPR gRNA targeting the C-terminal end of EGFR for cleavage.DepositorInsertgRNA targeting EGFR C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Px-PhiYFP-triplex-28-M13-28-pA
Plasmid#202047PurposeEncodes PhiYFP downstream of a cloning site for constructing a synthetic Cas-targeted promoter. 3’ UTR has a MALAT1 triplex, Csy4 28nt sites, and cloning site for gRNA to activate downstream targets.DepositorInsertPhiYFP
ExpressionMammalianAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-Triplex-28-M13-28-pA
Plasmid#202041PurposeEncodes a non-coding transcript expressed from the EF1a promoter that has a 3' UTR containing a MALAT1 triplex, Csy4 binding sites ("28"), and a cloning site for a Cas9 gRNA.DepositorInsertTriplex-28-M13-28 (noncoding)
ExpressionMammalianAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Px-PhiYFP-triplex-DR-M13-DR-pA
Plasmid#202046PurposeEncodes PhiYFP downstream of a cloning site for constructing a synthetic Cas-targeted promoter. 3’ UTR has a MALAT1 triplex, dCas12a DRs, and cloning site for crRNA to activate downstream targets.DepositorInsertPhiYFP
ExpressionMammalianAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA376 - pBA904 Puro-T2A-GFP NTC guide (pRCA360 backbone)
Plasmid#238167PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK2
Plasmid#233897Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADK2DepositorInsertsgRNA targeting NADK2 (NADK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-NT-1mer-gRNA
Plasmid#227500Purposenon-targeting control guideDepositorInsertNon-targeting gRNA
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shScg2-CWB
Plasmid#223659PurposeExpresses hM3D(Gq) and a shRNA targetting Scg2 in a Cre-dependent mannerDepositorInserthM3D(Gq)-mCherry and shScg2
UseAAV and RNAiTagsmCherryExpressionMammalianPromoterhSynAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPH07
Plasmid#234345PurposeLibrary-scale IPTG-inducible gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertType II dCas9 sgRNA
UseCRISPRExpressionBacterialPromoterlacUV5Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ITGB6
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_L31_CRISPR_downstream_sgRNA
Plasmid#235610PurposeEncodes CRISPR gRNA for cleaving downstream of insertion site at C terminus of mouse Rpl31DepositorInsertRpl31 C-terminus downstream sgRNA
UseCRISPRAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_L31_CRISPR_upstream_sgRNA
Plasmid#235609PurposeEncodes CRISPR gRNA for cleaving upstream of insertion site at C terminus of mouse Rpl31DepositorInsertRpl31 C-terminus upstream sgRNA
UseCRISPRAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_SlMIR164b
Plasmid#231152PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting SlMIR164bDepositorInsertTREX2 and mobile gRNA targeting SlMIR164b
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbSTM-5'UTR
Plasmid#231150PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbSTM-5?UTRDepositorInsertmobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbPDS
Plasmid#231146PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbPDSDepositorInsertTREX2 and mobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only