We narrowed to 5,211 results for: Mos;
-
Plasmid#239010Purpose3OC6-HSL quorum sensing signal producer under Ptrc inducible promoterDepositorInsertAcyl-homoserine-lactone synthase, 3OC6-HSL
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-UnaG-FLAG
Plasmid#203479PurposeFor Agrobacterium transformation. A plastid transit peptide fused UnaG-FLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertPlastid transit peptide fused UnaG-FLAG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-tagRFP
Plasmid#203482PurposeFor Agrobacterium transformation. tagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertTagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB560-NADK2
Plasmid#203760PurposeFor Agrobacterium transformation. tagRFP fused Arabidopsis thaliana NAD KINASE2 (NADK2) under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertNAD KINASE2
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMLS640
Plasmid#188892PurposettTi5605 MosSci targeting vector with Pmex-5::Cas9 and floxed Cbr-unc-119 markerDepositorInsertPmex-5::Cas9, Cbr-unc-119
ExpressionWormMutationC. elegans codom optimization and intron additionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lmajor_gp63_10_0460_P460G_D463N_S465A
Plasmid#171645PurposeExpression of L. major glcyoprotein-63 (P460G_D463N_S465A) with substrate binding site mutations from chromosome 10 in mammalian cellsDepositorInsertLmjF.10.0460 P460G D463N S465A
TagsMyc-HisExpressionMammalianMutationP460G; D463N; S465AAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT.334
Plasmid#119556PurposeLevel T acceptor vector for chromosomal integration with lacZ compatible with blue/white screening. Modified pUC19 vector.DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoA
Plasmid#117990PurposeChloroplast-targeted expression of CURT_fluoA controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoA
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoB
Plasmid#117991PurposeChloroplast-targeted expression of CURT_fluoB controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoB
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoE
Plasmid#117992PurposeChloroplast-targeted expression of CURT_fluoE controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoE
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CURT_flouB
Plasmid#117995PurposeExpression of CURT_flouB controlled by the CaMV 35S promoterDepositorInsertCURT_flouB
UseYeast/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB6637
Plasmid#106164PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6681 into Yarrowia lipolytica chromosomal location IntE_3, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti-gRNA-puro
Plasmid#180426PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.DepositorInsertgRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG-GFP-TurboID-3XNLS
Plasmid#209400PurposeTransiently expressing and visualizating the subcellular localization of TurboID fused with 3X nuclear localization signal (NLS) in plantaDepositorInsert3XHA-TurboID-3XNLS
TagsGFPExpressionPlantPromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-cTP-TurboID-GFP
Plasmid#209403PurposeTransiently expressing and visualizing the subcellular localization of TurboID fused with a chloroplast transit peptide (cTP) in plantaDepositorInsertPM-3XHA-TurbOID
TagsGFPExpressionPlantPromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-TurboID-3XNLS
Plasmid#209392PurposeTransiently expressing TurboID fused with 3X nuclear localization signal (NLS) in plantaDepositorInsert3XHA-TurboID-3XNLS
ExpressionPlantPromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-cTP-TurboID
Plasmid#209394PurposeTransiently expressing TurboID fused with a chloroplast transit peptide (cTP) in plantaDepositorInsertcTP-3XHA-TurboID
ExpressionPlantPromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-UTX-F
Plasmid#17438PurposeExpression of UTX in mammalian cellsDepositorAvailable SinceFeb. 19, 2008AvailabilityAcademic Institutions and Nonprofits only