We narrowed to 11,245 results for: ENA
-
Plasmid#189781PurposeCas12j2 (CasΦ) Gateway gRNA entry plasmid using Zea mays Ubi promoter and HH, HDV ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACE-GIRK2-mC-S
Plasmid#172428PurposeExpression of full-length, human GIRK4 with C-terminal mCherry StrepTag IIDepositorAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET303-ColE1-TR-E192C-del1-40
Plasmid#180235PurposeExpresses T and R domains of Colicin E1 with N-terminal 40 residue deletion (residues 41-364) with C terminal cysteine for maleimide chemistryDepositorInsertColicin E1
Tags6x His-tagExpressionBacterialMutationTruncation of ColE1 containing T and R domains (r…PromoterT7Available SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-scrambled
Plasmid#183455PurposeThis control vector contains a scrambled version of the targeting sequence used in the pFUGW-shRIIα constructDepositorInsertscrambled sgRNA
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_15278a
Plasmid#173545PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_15278_P17777
ExpressionPlantPromoter35SAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJ414-PCY1:S495A
Plasmid#98151PurposeExpresses PCY1:S495A from Saponaria vaccaria possesing a N-terminal His6-tag (TEV cleavable) in E. coli.DepositorInsertPeptide cyclase 1:S495A
TagsHis6-TEVExpressionBacterialMutationChanged serine 495 to alaninePromoterT7Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJ414-PCY1:W603A
Plasmid#98153PurposeExpresses PCY1:W603A from Saponaria vaccaria possesing a N-terminal His6-tag (TEV cleavable) in E. coli.DepositorInsertPeptide cyclase 1:W603A
TagsHis6-TEVExpressionBacterialMutationChanged tryptophan 603 to alaninePromoterT7Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJ414-PCY1:H695Q
Plasmid#98154PurposeExpresses PCY1:H695Q from Saponaria vaccaria possesing a N-terminal His6-tag (TEV cleavable) in E. coli.DepositorInsertPeptide cyclase 1:H695Q
TagsHis6-TEVExpressionBacterialMutationChanged histidine 695 to glutaminePromoterT7Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJ414-PCY1:H695A
Plasmid#98155PurposeExpresses PCY1H695A from Saponaria vaccaria possesing a N-terminal His6-tag (TEV cleavable) in E. coli.DepositorInsertPeptide cyclase 1:H695A
TagsHis6-TEVExpressionBacterialMutationChanged histidine 695 to alaninePromoterT7Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJ414-PCY1:Y696G
Plasmid#98156PurposeExpresses PCY1:R696G from Saponaria vaccaria possesing a N-terminal His6-tag (TEV cleavable) in E. coli.DepositorInsertPeptide cyclase 1:Y696G
TagsHis6-TEVExpressionBacterialMutationChanged tyrosine 696 to glycinePromoterT7Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmEDC3_441-680_D
Plasmid#146127PurposeInsect Expression of DmEDC3_441-680DepositorInsertDmEDC3_441-680 (Edc3 Fly)
ExpressionInsectMutation3 mutations N162T, K221E and D418G compared to th…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3_441-680_D
Plasmid#146130PurposeInsect Expression of DmEDC3_441-680DepositorInsertDmEDC3_441-680 (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-D61A_D
Plasmid#146131PurposeInsect Expression of DmEDC3-D61ADepositorInsertDmEDC3-D61A (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-D61K_D
Plasmid#146132PurposeInsect Expression of DmEDC3-D61KDepositorInsertDmEDC3-D61K (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmEDC3-N44A_D
Plasmid#146135PurposeInsect Expression of DmEDC3-N44ADepositorInsertDmEDC3-N44A (Edc3 Fly)
ExpressionInsectMutationone silent mutation A456G and three mutations N16…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK-eCFP
Plasmid#176559PurposeExpression of eCFP for auxotrophic selection in the absence of histidineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceDec. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_14371
Plasmid#173567PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_14371_T30-4
ExpressionPlantPromoter35SAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only