We narrowed to 6,946 results for: crispr cas9 plasmids
-
Plasmid#132467PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF302 (ZNF302 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF253.1.0-gDNA
Plasmid#132461PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF253 (ZNF253 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZFPM2.1.0-gDNA
Plasmid#132459PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZFPM2 (ZFPM2 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF3.1.0-gDNA
Plasmid#132440PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSHZ1.1.0-gDNA
Plasmid#132434PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTSHZ1 (TSHZ1 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_HHEX_1
Plasmid#72354PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_HHEX_2
Plasmid#72355PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only