We narrowed to 18,016 results for: Gateway
-
Plasmid#234239PurposeGateway ORF Entry clone of human TGFB1 with stop codon (for native or N-terminal fusions)DepositorInsertTGFB1 (TGFB1 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E24
Plasmid#234261PurposeGateway ORF Entry clone of human AMHR2 with stop codon (for native or N-terminal fusions)DepositorInsertAMHR2 (AMHR2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E42
Plasmid#234279PurposeGateway ORF Entry clone of mouse Acvr1b with stop codon (for native or N-terminal fusions)DepositorInsertAcvr1b (Acvr1b Mouse)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8061-E45
Plasmid#234282PurposeGateway ORF Entry clone of mouse Acvr2a with stop codon (for native or N-terminal fusions)DepositorInsertAcvr2a (Acvr2a Mouse)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8522-E08
Plasmid#234293PurposeGateway ORF Entry clone of mouse Tgfbr1 with stop codon (for native or N-terminal fusions); N/267A/D269A/N270A mutationsDepositorInsertTgfbr1 N/267A/D269A/N270A (Tgfbr1 Mouse)
UseGateway entry cloneTagsExpressionMutationN/267A/D269A/N270APromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E05
Plasmid#234300PurposeGateway ORF Entry clone of human Tgfbr1 with stop codon (for native or N-terminal fusions); T204D mutationDepositorInsertTGFBR1 T204D (TGFBR1 Human)
UseGateway entry cloneTagsExpressionMutationT204DPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E06
Plasmid#234301PurposeGateway ORF Entry clone of human TGFBR1 with stop codon (for native or N-terminal fusions); K232R mutationDepositorInsertTGFBR1 K232R (TGFBR1 Human)
UseGateway entry cloneTagsExpressionMutationK232RPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E15
Plasmid#234303PurposeGateway ORF Entry clone of human TGFBR2 iso1 with stop codon (for native or N-terminal fusions)DepositorInsertTGFBR2 iso1 (TGFBR2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR/hBIG1
Plasmid#226251PurposeEntry plasmid of hBIG1 for Gateway systemDepositorInsertBIG1 (ARFGEF1 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hspa13
Plasmid#192730PurposeGateway entry vector encoding zebrafish hspa13DepositorInserthspa13 (hspa13 Zebrafish)
UseGateway entry vectorTagsExpressionMutationF48L (rs504983321)PromoterNoneAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorInsertdyrk1aa (dyrk1aa Zebrafish)
UseGateway entry vectorTagsExpressionMutationPromoterNoneAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorTagsExpressionMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ets2
Plasmid#192724PurposeGateway entry vector encoding zebrafish ets2DepositorInsertets2 (ets2 Zebrafish)
UseGateway entry vectorTagsExpressionMutationN189D (rs502796915); S231NPromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
R777-E338 Hs.STK3-nostop
Plasmid#70622PurposeGateway ORF clone of human STK3 [NM_006281.3] without stop codon (for C-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E300 Hs.RPS6KB2-nostop
Plasmid#70584PurposeGateway ORF clone of human RPS6KB2 [NM_003952.2] without stop codon (for C-terminal fusions)DepositorInsertRPS6KB2 (RPS6KB2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E278 Hs.RHOA-nostop
Plasmid#70562PurposeGateway ORF clone of human RHOA [NM_001664.2] without stop codon (for C-terminal fusions)DepositorInsertRHOA (RHOA Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E194 Hs.PRKAA2-nostop
Plasmid#70478PurposeGateway ORF clone of human PRKAA2 [NM_006252.3] without stop codon (for C-terminal fusions)DepositorInsertPRKAA2 (PRKAA2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E082 Hs.EXOC8-nostop
Plasmid#70366PurposeGateway ORF clone of human EXOC8 [NM_175876.4] without stop codon (for C-terminal fusions)DepositorInsertEXOC8 (EXOC8 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E058 Hs.EIF4EBP2-nostop
Plasmid#70342PurposeGateway ORF clone of human EIF4EBP2 [NM_004096.4] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP2 (EIF4EBP2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E060 Hs.EIF4EBP3-nostop
Plasmid#70344PurposeGateway ORF clone of human EIF4EBP3 [NM_003732.2] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP3 (EIF4EBP3 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human-Dysferlin-Original
Plasmid#60216PurposeHuman dysferlin (accession #NM_003494) cDNA in pDONR221 plasmid which can be used as an entry vector for Invitrogen’s gateway system.DepositorInsertDysferlin (DYSF Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 FLAG-APEX2-P4C-IRES-mNeonGreen
Plasmid#218645PurposeGateway shuttling vector for APEX2-tagged P4C, a P4C biosensorDepositorInsertSidC(P4C)
UseGateway entryTagsExpressionMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
R777-E015 Hs.BRAF
Plasmid#70299PurposeGateway ORF clone of human BRAF [NM_004333.4] with stop codon (for native or N-terminal fusions)DepositorInsertBRAF (BRAF Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_mCherry
Plasmid#221470PurposeGateway cloning of mCherry overexpressionDepositorInsertmCherry
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
LO601: pMVP (R4-R3) destabilized firefly luciferase (Luc2P)
Plasmid#132926PurposepMVP R4-R3 entry plasmid, contains destabilized Firefly Luciferase (Luc2P) for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInsertLuc2P
UseLuciferase and Synthetic Biology; Pmvp gateway en…TagsPEST destabilization domainExpressionMutationPromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E213 Hs.RAF1
Plasmid#70497PurposeGateway ORF clone of human RAF1 [NM_002880.3] with stop codon (for native or N-terminal fusions)DepositorInsertRAF1 (RAF1 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-GFP-V5_IDG-K
Plasmid#135242PurposeGateway destination clone of GFP (as control) tagged with C-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertGFP-V5
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianMutationPromoterUbiquitinAvailable sinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E013 Hs.ARHGEF2
Plasmid#70297PurposeGateway ORF clone of human ARHGEF2 [NM_001162383.1] with stop codon (for native or N-terminal fusions)DepositorInsertARHGEF2 (ARHGEF2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GFP
Plasmid#221469PurposeGateway cloning of GFP overexpressionDepositorInsertEGFP
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
R777-E063 Hs.ETS1
Plasmid#70347PurposeGateway ORF clone of human ETS1 [NM_005238.3] with stop codon (for native or N-terminal fusions)DepositorInsertETS1 (ETS1 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-Flag-GFP_IDG-K
Plasmid#135275PurposeGateway destination clone of GFP (as control) tagged with N-terminal Flag for generating protein-protein networks using fusion tag affinity-based proteomicsDepositorInsertFlag-GFP
UseLentiviral; Gateway destinationTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
R777-E114 Hs.JUN-nostop
Plasmid#70398PurposeGateway ORF clone of human JUN [NM_002228.3] without stop codon (for C-terminal fusions)DepositorInsertJUN (JUN Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E012 Hs.ARHGAP35-nostop
Plasmid#70296PurposeGateway ORF clone of human ARHGAP35 [NM_004491.4] without stop codon (for C-terminal fusions)DepositorInsertARHGAP35 (ARHGAP35 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E127 Hs.MAPK3
Plasmid#70411PurposeGateway ORF clone of human MAPK3 [NM_002746.2] with stop codon (for native or N-terminal fusions)DepositorInsertMAPK3 (MAPK3 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E091 Hs.FLT3
Plasmid#70375PurposeGateway ORF clone of human FLT3 [NM_004119.2] with stop codon (for native or N-terminal fusions)DepositorInsertFLT3 (FLT3 Human)
UseGateway entry cloneTagsExpressionMutationT227M (human SNP)PromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E113 Hs.JUN
Plasmid#70397PurposeGateway ORF clone of human JUN [NM_002228.3] with stop codon (for native or N-terminal fusions)DepositorInsertJUN (JUN Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E014 Hs.ARHGEF2-nostop
Plasmid#70298PurposeGateway ORF clone of human ARHGEF2 [NM_001162383.1] without stop codon (for C-terminal fusions)DepositorInsertARHGEF2 (ARHGEF2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E016 Hs.BRAF-nostop
Plasmid#70300PurposeGateway ORF clone of human BRAF [NM_004333.4] without stop codon (for C-terminal fusions)DepositorInsertBRAF (BRAF Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E145 Hs.NRAS
Plasmid#70429PurposeGateway ORF clone of human NRAS [NM_002524.4] with stop codon (for native or N-terminal fusions)DepositorInsertNRAS (NRAS Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E271 Hs.RB1
Plasmid#70555PurposeGateway ORF clone of human RB1 [NM_000321.2] with stop codon (for native or N-terminal fusions)DepositorInsertRB1 (RB1 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only