We narrowed to 6,383 results for: Mag
-
Plasmid#199445PurposeExpression of GFP-RPA43 in mammalian cellsDepositorInsertRPA43 (POLR1F Human)
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterSFFVAvailable sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-TREX1(D18N)
Plasmid#27220DepositorInsertTREX1 (TREX1 Human)
UseTagsGFPExpressionMammalianMutationD18N sequence 52-GAC changed to AAC, resulting i…PromoterAvailable sinceJan. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
Synapsin-cyto-mRuby3-iATPSnFR1.0
Plasmid#102557Purposeexpresses cytoplasmic ATP sensor in neurons with red reference proteinDepositorInsertmRuby3-iATPSnFR1.0
UseAAVTagsRuby3ExpressionMutationPromoterAvailable sinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCytERM_mScarlet-i_N1
Plasmid#85068PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
UseTagsmScarlet-iExpressionMammalianMutationaa1-29PromoterCMVAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
smHA multi-frame tag
Plasmid#128611Purposea spaghetti monster with 10x HA epitopes repeat upstream of the HIV frameshift sequence which is followed by FLAG epitopes in the 0ORF are separated from one another by SunTag epitopes in the -1ORF.DepositorInsertsmHA MF tag
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(Cyto)iGlucoSnFR.mRuby2
Plasmid#164514PurposeGreen glucose sensor with mRuby2 fusion, cytosolicDepositorInsert(Cyto)iGlucoSnFR-mRuby2
UseAAVTagsExpressionMutationSynthetic ConstructPromoterGFAPAvailable sinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pF3BGX-7xGFP11
Plasmid#138397PurposeRMCE vector for generating C-terminal fusion of seven tandem GFP11 tags (split GFP)DepositorInsert7xGFP11
UseTagsExpressionInsectMutationPromoterAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-DNAPKcs HRD
Plasmid#207088PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous DNA-PKcs locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human DNAPKcs locus sequences
UseTagsHaloTagExpressionMammalianMutationPromoterEndogenousAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+cPLA2-mKate2
Plasmid#162068PurposeUsed to provide a steady-state readout of cPLA2 activation in live cells. Amino-terminally fused to mKate2 for red fluorescence.DepositorInsertcytosolic phospholipase a2 (pla2g4aa Zebrafish)
UseAvian, xenopus, zebrafishTagsmKate2ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 1, 2021AvailabilityAcademic Institutions and Nonprofits only