We narrowed to 18,622 results for: Met;
-
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pReporter_2
Plasmid#60563PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_2
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBPHLWL-GAL4DBD
Plasmid#26256DepositorInsertZIP- Gal4DBD (GAL4 Budding Yeast)
UseDrosophila transgenesisExpressionBacterial and InsectAvailable SinceFeb. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
Kohinoor/pcDNA3
Plasmid#67771PurposeKohinoor for mammalian cell expression in cytosolDepositorInsertKohinoor
ExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRATIO2212
Plasmid#141302PurposeGateway cloning compatible dual fluorescent ratiometric binary vectorDepositorTypeEmpty backboneTagsmScarlet-I and mVenusExpressionPlantPromoterUBQ10 promoterAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
PH-dL5**
Plasmid#96946PurposePLC pleckstrin homology domain linked to FAP for CALI validationDepositorInsertPleckstrin homology domain
TagsdL5 and mCeruleanExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
GatA_pET29b
Plasmid#215406PurposeExpression construct for GatA gene, codon optimized for expression in E. coliDepositorInsertGatA
ExpressionBacterialAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG25-L-IFP-F[1] (clon 3)
Plasmid#52899PurposePlasmid template for PCR of cassettes for HR, used to introduce IFP F[1] fragments 3’ to the ORF of the genes to study. Plasmid confers ampicillin resistance to DH5α.DepositorInsertL-IFP-F[1]
UseVector for homologous recombinationPromoterTEF promoterAvailable SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAG32-L-IFP-F[2] (clon 3)
Plasmid#52900PurposePlasmid template for PCR of cassettes for HR, used to introduce IFP F[2] fragments 3’ to the ORF of the genes to study. Plasmid confers ampicillin resistance to DH5α.DepositorInsertL-IFP-F[2]
UseVector for homologous recombinationPromoterTEF promoterAvailable SinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
EGFP-PH-dL5**
Plasmid#96947PurposeExpresses EGFP-PLC pleckstrin homology domain linked to FAP for CALI validationDepositorInsertPleckstrin homology domain
TagsEGFP and dL5ExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only