We narrowed to 5,362 results for: crispr cas9 grna plasmid
-
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-gRNA
Plasmid#215547PurposegRNA targeting B2M to introduce splice donor mutation on the first intron of the locusDepositorInsertB2M (B2M Human)
UseCRISPRAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
px459ver2.0-FKBP8-gRNA1 (for mouse)
Plasmid#253968PurposeCRISPR/Cas9 (PX459) plasmid expressing gRNA N-terminal knock-in of mouse Fkbp8.DepositorAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-sgRNA scaffold
Plasmid#226921PurposeEncoding SauriABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSauriCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Nme2-U6-sgRNA scaffold
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA103
Plasmid#245325PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA101
Plasmid#245323PurposeCas9 CRISPRa positive control guide; targets CD274DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_837
Plasmid#245328PurposeCas9 CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA104
Plasmid#245326PurposeCas9 CRISPRa positive control guide; targets CD4DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA102
Plasmid#245324PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgCTG-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222857PurposeThis plasmid codes for the Slug-KH nickase with a sg(CTG)6DepositorInsertSlug-KHD10A+sgCTG
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgAGC-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222859PurposeThis plasmid codes for the Slug-KH nickase with a sg(AGC)6DepositorInsertSlug-KHD10A+sgAGC
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgGCA-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222860PurposeThis plasmid codes for the Slug-KH nickase with a sg(GCA)6DepositorInsertSlug-KHD10A+sgGCA
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA099
Plasmid#245321PurposeCas9 CRISPRko all-in-one positive control; targets CD59DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_MET16
Plasmid#166091PurposePlasmid for constituive spCas9 and tet-inducible MET16 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMay 14, 2021AvailabilityAcademic Institutions and Nonprofits only