We narrowed to 15,742 results for: grna
-
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-trmI
Plasmid#89955PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting trmI.DepositorInserttrmI gRNA
UseTagsExpressionBacterialMutationPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-pfkB
Plasmid#102284PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting pfkB.DepositorInsertpfkB gRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-xylA
Plasmid#89964PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting xylA.DepositorInsertxylA gRNA
UseTagsExpressionBacterialMutationPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-lpoB
Plasmid#89959PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting lpoB.DepositorInsertlpoB gRNA
UseTagsExpressionBacterialMutationPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_3
Plasmid#73527PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_4
Plasmid#73528PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_2
Plasmid#73526PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for1
Plasmid#81210Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
UseTagsExpressionMammalianMutationPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev1
Plasmid#81208Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
UseTagsExpressionMammalianMutationPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA_zebrafish_mmp21
Plasmid#72890Purposeplasmid to generate guideRNA against mmp21 gene in zebrafishDepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_4
Plasmid#242899PurposePiggyBac cargo vector with HNRNPK sgRNA 4 for dox-inducible knockdownDepositorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_1
Plasmid#242897PurposePiggyBac cargo vector with HNRNPK sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_3
Plasmid#242898PurposePiggyBac cargo vector with HNRNPK sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B0_M13ps
Plasmid#231421PurposeM13 phagemid constitutively expressing sgRNA-B0. sgRNA-B0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ552.)DepositorInsertsgRNA-B0
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B1_M13ps
Plasmid#231422PurposeM13 phagemid that expresses sgRNA-B1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ615.)DepositorInsertsgRNA-B1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
UseTagsExpressionMammalianMutationPromoterAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX330-sgRNA006_CTCF
Plasmid#232928PurposeExpression vector for a sgRNA against the mouse CTCF locus and SpCas9.DepositorAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA047_Podxl
Plasmid#232932PurposeExpression vector for a sgRNA against the mouse Podxl locus and SpCas9 with T2A-Puromycin resistance gene.DepositorAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
EHMT1_exon 3_gRNA
Plasmid#228809PurposeCRISPR targeting of human EHMT1DepositorInsertgRNA targeting EHMT1 exon 3 (EHMT1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbATML1-1pro
Plasmid#231151PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbATML1-1proDepositorInsertmobile gRNA targeting NbATML1-1pro
UseTagsExpressionPlantMutationPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbSTM-5'UTR
Plasmid#231150PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbSTM-5?UTRDepositorInsertmobile gRNA targeting NbSTM-5?UTR
UseTagsExpressionPlantMutationPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C1_M13ps
Plasmid#231411PurposeM13 phagemid that expresses sgRNA-C1 (= sgRNA A5T from Nielsen et al., 2014) from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ272.)DepositorInsertsgRNA-C1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-2_M13ps
Plasmid#231412PurposeM13 phagemid that expresses sgRNA-2 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ171.)DepositorInsertsgRNA-2
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A0_M13ps
Plasmid#231413PurposeM13 phagemid constitutively expressing sgRNA-A0. sgRNA-A0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI).DepositorInsertsgRNA-A0
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_LacI_pLac-sgRNA-1
Plasmid#231408PurposesgRNA-1 expression from an IPTG-inducible promoter.DepositorInsertssgRNA-1
LacI
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_AraC_pBAD-sgRNA-1
Plasmid#231407PurposesgRNA-1 expression from an arabinose-inducible promoter.DepositorInsertssgRNA-1
AraC
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A1_M13ps
Plasmid#231414PurposeM13 phagemid that expresses sgRNA-A1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ164.)DepositorInsertsgRNA-A1
UseTagsExpressionMutationPromoterAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C0_M13ps
Plasmid#231410PurposeM13 phagemid constitutively expressing sgRNA-C0. sgRNA-C0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ156.)DepositorInsertsgRNA-C0
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only