We narrowed to 17,815 results for: Por
-
Plasmid#33382DepositorInsertZinc finger array targeting atp2c1 (atp2c1 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
col6a2_R (OZ594)
Plasmid#35234DepositorInsertZinc finger array targeting col6a2 (col6a2 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
col6a2_L (OZ593)
Plasmid#35233DepositorInsertZinc finger array targeting col6a2 (col6a2 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
flt1_L (OZ585)
Plasmid#35225DepositorInsertZinc finger array targeting flt1 (flt1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
flt1_R (OZ586)
Plasmid#35226DepositorInsertZinc finger array targeting flt1 (flt1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
hnf1a_R (OZ522)
Plasmid#27197DepositorInsertZinc finger array targeting hnf1a (hnf1a Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
hnf1a_L (OZ521)
Plasmid#27196DepositorInsertZinc finger array targeting hnf1a (hnf1a Zebrafish)
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
Kif6_L (OZ537)
Plasmid#27214DepositorInsertZinc finger array targeting Kif6 (kif6 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
Kif6_R (OZ538)
Plasmid#27215DepositorInsertZinc finger array targeting Kif6 (kif6 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
GUSB_L (OZ551)
Plasmid#28076DepositorInsertZinc finger array targeting GUSB (gusb Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
GUSB_R (OZ552)
Plasmid#28077DepositorInsertZinc finger array targeting GUSB (gusb Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
dpf2_L (OZ531)
Plasmid#27208DepositorInsertZinc finger array targeting dpf2 (dpf2 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
dpf2_R (OZ532)
Plasmid#27209DepositorInsertZinc finger array targeting dpf2 (dpf2 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS2+Brd9 (zebrafish) partial UTR and coding sequence-EGFP
Plasmid#248787Purposefuse partial UTR and coding sequence of Brd9 (zebrafish) with EGFP reporterDepositorInsertbrd9 (brd9 Zebrafish)
UseBrd9(zebrafish)-egfp reporterTagsEGFPPromoterpartial 5'UTR sequence of zebrafish brd9Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-TOM20-HK2-3xFLAG
Plasmid#239245PurposeTOM20-HK2 lentiviral overexpression vectorDepositorUseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterCMVAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-TOM20-HK2-3xFLAG
Plasmid#239256PurposeTOM20-HK2 lentiviral overexpression vectorDepositorUseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL GNAS EE K32R
Plasmid#249277PurposeExpression of Galphas K32R mutant (GNASK32R) EE-tagged (internal)DepositorInsertGNAS (GNAS Human)
TagsInternal EE tagExpressionMammalianMutationGNAS-K32R Internal EE-tagPromoterEF-1Available SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL GNAS EE N218I
Plasmid#249279PurposeExpression of Galphas N218I mutant (GNASN218I) EE-tagged (internal)DepositorInsertGNAS (GNAS Human)
TagsInternal EE tagExpressionMammalianMutationGNAS-N218I Internal EE-tagPromoterEF-1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL GNAS EE P116L
Plasmid#249278PurposeExpression of Galphas P116L mutant (GNASP116L) EE-tagged (internal)DepositorInsertGNAS (GNAS Human)
TagsInternal EE tagExpressionMammalianMutationGNAS-P116L Internal EE-tagPromoterEF-1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL GNAS EE WT
Plasmid#249276PurposeExpression of Galphas (GNAS) wild type EE-tagged (internal)DepositorInsertGNAS (GNAS Human)
TagsInternal EE tagExpressionMammalianMutationInternal EE-tagPromoterEF-1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL GNAS EE T350I
Plasmid#249280PurposeExpression of Galphas T350I mutant (GNAST350I) EE-tagged (internal)DepositorInsertGNAS (GNAS Human)
TagsInternal EE tagExpressionMammalianMutationGNAS-T350I Internal EE-tagPromoterEF-1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA092 CCT3_IVS13-Cas9-BFP
Plasmid#249142PurposeOverexpression of SpCas9-BFP with CCT3 IVS13 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCCT3_IVS13-Cas9-TagBFP (CCT3 S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationCCT3 IVS13 intronPromoterEF1aAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA144 HBB_IVS2-Cas9-BFP with core cHS4 insulators
Plasmid#249154PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Flanked by cHS4 core insulators. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-Cas9-TagBFP with core cHS4 insulators (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA074 Cas9-BFP/HBB_IVS2/BFP
Plasmid#249135PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within BFP coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP/HBB_IVS2/TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA089 AARS1_IVS11-Cas9-BFP
Plasmid#249139PurposeOverexpression of SpCas9-BFP with AARS IVS11 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertAARS1_IVS11-Cas9-TagBFP (AARS S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationAARS IVS11 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA076 Cas9/HBB_IVS2/Cas9-BFP
Plasmid#249137PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9/HBB_IVS2/Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA095 EEF2_IVS9-Cas9-BFP
Plasmid#249145PurposeOverexpression of SpCas9-BFP with EEF2 IVS9 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertEEF2_IVS9-Cas9-TagBFP (EEF2 S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationEEF2 IVS9 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA094 UBA1_IVS20-Cas9-BFP
Plasmid#249144PurposeOverexpression of SpCas9-BFP with UBA1 IVS20 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertUBA1_IVS20-Cas9-TagBFP (UBA1 S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationUBA1 IVS20 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
CD8a-AA347-363- RVEP-4A-GFP
Plasmid#221597PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with RVEP4A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CD8a-AA347-363-KRN-3A-GFP
Plasmid#221598PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with KRN-3A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC-IRES-Blasti
Plasmid#242462PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_G198R
Plasmid#242465PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199R
Plasmid#242466PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199G
Plasmid#242467PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199G mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_ANK3-4
Plasmid#242468PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The ANK3-4 mutations disrupt XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationANK3-4 = R87A - E95A - K96A - W124G - K128GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-CMV-myc-XPO1_H10-11
Plasmid#242471PurposeExpresses human XPO1 protein with an N-terminal cMyc tag. The H10-11 mutations disrupt ASB8 binding.DepositorInsertXPO1 (XPO1 Human)
TagscMycExpressionMammalianMutationXPO1 H10-11 = E478A - H481A - V484G - N485G - T48…PromoterCMVAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-Tag100-hASB8_G198R
Plasmid#242461PurposeExpresses human ASB8 protein with an N-terminal Tag100 along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTagsTag100ExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC_K7R-IRES-Blasti
Plasmid#242463PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker. The K7R mutations prevent ubiquitin chain elongation.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitRatioGFP:LAAQ
Plasmid#240451PurposeExpression of indicator protein fusion (modified ratiometric pHluorin & low affinity Aequorin) for monitoring calcium concentrations and pH in cell walls of higher plants. See Resource Information.DepositorInsertFusion of chitinase signal, soluble modified ratiometric pHluorin and low affinity Aequorin (D119A)
ExpressionBacterial and PlantMutationRatiometric GFP (ratiometric pHluorin) (PMID 9671…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only