We narrowed to 11,282 results for: VARS
-
Plasmid#197422PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #2 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#3
Plasmid#197423PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #3 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1
Plasmid#197424Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
Plasmid#197425Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.2
Plasmid#201404PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet-Seq1.1
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-In18runon-PTPN22
Plasmid#195377PurposeA human PTPN22 mutant (intron 18-runon) in Gateway pDONR221DepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (K57A)
Plasmid#197118PurposeExpression of kinase-defective MYC-tagged PSK2 (K57A) / TAOK1 (K57A) in mammalian cellsDepositorInsertTAOK1 (K57A) (TAOK1 Human)
TagsMycExpressionMammalianMutationChanged K 57 to APromoterSV40Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-In18runon-PTPN22
Plasmid#195379PurposeMammalian expression of a human PTPN22 mutant (intron 18-runon) with FLAG tagDepositorAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-PTPN22
Plasmid#195375PurposeMammalian expression of a human PTPN22 mutant (exon 1-17) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-γ1
Plasmid#197078PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 γ1 fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-1 γ1 (Ap1g1 Mouse)
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HTR2A-NTEV-TCS-GV-2xHA
Plasmid#194366PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-NTEV-TCS-GV-2xHA
Plasmid#194371PurposeSplit TEV assaysDepositorInsertSP-AVPR2-NTEV-TCS-GV-2xHA (AVPR2 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-GLP1R-NTEV-TCS-GV-2xHA
Plasmid#194379PurposeSplit TEV assaysDepositorInsertSP-GLP1R-NTEV-TCS-GV-2xHA (GLP1R Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD1-NTEV-TCS-GV-2xHA
Plasmid#194359PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD1-V2R-NTEV-TCS-GV-2xHA
Plasmid#194360PurposeSplit TEV assaysDepositorInsertDRD1-V2R-NTEV-TCS-GV-2xHA (DRD1 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only