We narrowed to 6,180 results for: cas9 expression plasmid
-
Plasmid#106259PurposeExpresses MPH co-activator from the CAG promoter and one U6-driven dgRNA in AAV backboneDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60227PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA targeting the mouse gene NeuN. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.1)-CMV-eGFP
Plasmid#194015PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.1)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMV and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL90-Nat-2xHO
Plasmid#139069PurposeCRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selectionDepositorInsertTwo guide RNAs targeting the HO endonuclease
ExpressionBacterial and YeastPromoterTDH3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
px459 sgFIP200
Plasmid#175024PurposeCRISPR-Cas9 plasmid targeting exon 3 of human FIP200.DepositorInsertRB1CC1 (RB1CC1 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Syt1LeftArm-3XGS-GCaMP6s-SV40-3XP3-dsRed-SV40-Syt1RightArm
Plasmid#159636PurposeDonor plasmid for generating Syt1:GCaMP6s strain in Aedes aegypti with CRISPR/Cas9DepositorInsertGCaMP6s
ExpressionInsectAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-WT-P2A-EGFP (BKS953)
Plasmid#242651PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-P2A-EGFP
UseCRISPRExpressionMammalianMutationABE8.8 mutations in TadAPromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRhaB-8xHis-ABE8e-eVRQR (LLH551)
Plasmid#242658PurposepRhaB promoter expression plasmid for ABE8e-eVRQR with an N-terminal His8-tagDepositorInsertpRhaB-8xHis-BPNLS-TadA8e-SpCas9(D10A)-eVRQR-BPNLS
UseCRISPRTags8x-HisExpressionBacterialMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterRhaBAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eVRQR-P2A-EGFP (KAC1028)
Plasmid#242663PurposeCMV promoter expression plasmid for human codon optimized SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFPDepositorInsertpCMV-SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFP
UseCRISPRTagsBPNLSExpressionMammalianMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1181 - pmU6(loxP-STOP-loxP) BbsI gRNA
Plasmid#113160PurposeA plasmid for cloning Cre-dependent guide RNAs using a modified mouse U6 promoter containing loxPDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromotermU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1442 - pAAV CMV-IE Nuc-iRFP-2A-iCre
Plasmid#112683PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and improved Cre recombinaseDepositorInsertiRFP713
UseAAVTags2A-iCre and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1440 - pAAV CMV-IE Nuc-iRFP-2A-Flpo
Plasmid#112684PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and optimized Flp recombinaseDepositorInsertiRFP713
UseAAVTags2A-Flpo and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF19_sgRNA
Plasmid#246404PurposeCas9/sgRNA expression plasmid targeting PHF19DepositorInsertPHF19 (PHF19 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a MS2-Fkbp2x 2A Hygro
Plasmid#102807PurposeLentiviral plasmid from FIRE-Cas9 system to express MS2-Fkbp2x fusion proteinDepositorInsertMS2-Fkbp2x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only