We narrowed to 12,325 results for: NSI
-
Plasmid#215399PurposeCm NCPPB382 cspA2 codon-optimized for E. coli recombinant protein expression (6xHis-CspA2)DepositorInsertcspA2
Tags6xHis TagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-11_humanized-mutant
Plasmid#214316PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-4_R269D
Plasmid#214310PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Myc-Caspase-4_K356D
Plasmid#214309PurposeExpression of gene in mammalian cells by retroviral transductionDepositorAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
Sars Cov 2 MPRO R188S mutantSARS-CoV-2 Mpro protease (R188S mutant - clinical mutant); aliases: 3CLpro, 3C-like
Plasmid#204785PurposeBacterial expression of Sars Cov 2 MPRO R188S mutantDepositorAvailable SinceJan. 23, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
ZIKV NS2B-NS3 protease (H115A- catalytically inactive); aliases: Zika Virus NS2B-NS3 fusion protein expressed with N-terminal Tw
Plasmid#204791PurposeBacterial expression of a fusion of Zika NS2B-NS3 proteinsDepositorInsertZika NS2B-NS3 fusion
Tags6 HisExpressionBacterialAvailable SinceJan. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
WNV NS2B-NS3 protease (based on PDB 2IJO, catalytically active); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204799PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceDec. 11, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
SARS-CoV-2 Mpro protease (R188K mutant - clinical mutant); aliases: 3CLpro, 3C-like
Plasmid#204770PurposeBacterial expression of Sars Cov 2 MPRO R188K mutantDepositorAvailable SinceNov. 30, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MsACR1-pmCerulean3-N1
Plasmid#204958PurposeExpression of channelrhodopsin MsACR1 fused to mCerulean3 in mammalian cellsDepositorInsertMsACR1
TagsmCerulean3ExpressionMammalianPromoterCMV (+enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-UnaG-FLAG
Plasmid#203479PurposeFor Agrobacterium transformation. A plastid transit peptide fused UnaG-FLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertPlastid transit peptide fused UnaG-FLAG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-tagRFP
Plasmid#203482PurposeFor Agrobacterium transformation. tagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertTagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 AMSHLP 16-218
Plasmid#180609PurposeBacterial expression for AMSHLP MIT domain residues 16-218. Internal ID: WISP20-83DepositorInsertAMSHLP residues 16-218
TagsHIS-SUMOExpressionBacterialMutationResidues 16-218PromoterT7Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-Cre-StLS1-9
Plasmid#197722PurposePhytobrick (MoClo) Level 0 PartDepositorInsertCre recombinase with St-LS1 intron (maize optimized)
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-CinH-9
Plasmid#197729PurposePhytobrick (MoClo) Level 0 PartDepositorInsertCinH recombinase (tomato optimized)
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-ELuc-9
Plasmid#197736PurposePhytobrick (MoClo) Level 0 PartDepositorInsertEmerald/Enhanced Click Beetle Luciferase (ELuc) (tomato codon-optimized)
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-L2-Reverse-Donor-BsaI
Plasmid#197843PurposeDonor vector to restore L2 destination via BsaI (reverse orientation)DepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-L2-Reverse-Donor-Esp3I
Plasmid#197844PurposeDonor vector to restore L2 destination via Esp3I (reverse orientation)DepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tornado-RNA sensor for survivin
Plasmid#185405Purposecircular RNA-scaffolded sensing modules for survivinDepositorInsertcircular RNA-scaffolded sensing modules
ExpressionMammalianMutationWTPromoterU6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only