We narrowed to 23,593 results for: promoter
-
Plasmid#27085DepositorAvailable SinceMay 17, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pPonA-BI-Gl NORM-LacZA TER- LacZB
Plasmid#86212Purposebeta Globin NMD construct with and without PTC under Bi-directional Ponasterone A inducible promoterDepositorUsePonasterone a inducible promoterTagslacZA or lacZBExpressionMammalianMutation39TER in beta Globin in MCS IIPromoterPonasterone A inducibleAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(EF1a)-TTN
Plasmid#172327PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato 2a HSVtk 2a Neo followed by an EF1a promoter driving nuclear d2eGFP E2A HygromycinDepositorInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterEF1-alphaAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAW62.YY1.FKBP.knock-in.mCherry
Plasmid#104370PurposeFor knocking in FKBP F36V P2A mCherry onto YY1DepositorInsertFKBP12(F36V) -P2A-mCherry
Available SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUCas9Cherry
Plasmid#70182PurposeExpresses Cas9 with fluorescent Cherry reporterDepositorInserthumanised S.pyogenes cas9
UseCRISPR and LentiviralTags3xFLAGExpressionMammalianPromoterhUbCAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1_Neo
Plasmid#125593PurposeLentiviral expression of sgRNA with GFP and neomycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-P2A-EGFP (RTW3027)
Plasmid#139987PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
-5.5kb-UCP1-GFP
Plasmid#104585PurposeReporter assay to monitor the transcription activity of the UCP1 promoter by GFP expressionDepositorAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-BP1-2 pLPC-Puro
Plasmid#19835DepositorInsertFragment of p53-Binding Protein 1 (TP53BP1 Human)
UseRetroviralTagsmCherryMutationFragment of human 53BP1 aa 1220 - 1711Available SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 3xHA-KillerRed-OMP25
Plasmid#174544Purposelocalizes KillerRed to mitochondriaDepositorInsert3xHA-KillerRed-OMP25
UseLentiviralExpressionMammalianAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
LcV2-Hygro
Plasmid#91977PurposeLentiCRISPR v2 with Hygro cloned in place of PuroDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-TAZ
Plasmid#32839DepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pL
Plasmid#196286Purpose35S promoter-driven expression of the positive-sense TSWV L RNA segment encoding codon-optimized L (RdRp)DepositorInsertFull length TSWV L antigenome encoding codon-optimized L (RdRp)
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgSTAT3-1
Plasmid#121425PurposesgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgSTAT3-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pM-CBE
Plasmid#196293Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding CBE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding CBE in place of viral GP
UseCRISPRTags3×flagExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Parkin
Plasmid#17613DepositorAvailable SinceApril 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
HBV 1.3-mer X-null replicon
Plasmid#65461Purposecontaining 1.3 units of the X-null HBV genome (subtype ayw)DepositorInsert1.3 units of the X-null HBV genome
ExpressionMammalianAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-B2M-miniGag-Cas9
Plasmid#228958PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only