We narrowed to 10,546 results for: Uty
-
Plasmid#155069PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_2
Plasmid#155070PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_1
Plasmid#155073PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_2
Plasmid#155074PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_3
Plasmid#155067PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g1)-PGKpuroBFP-W
Plasmid#105035PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Kcmf1-g1)-PGKpuroBFP-W
Plasmid#105017PurposeLentiviral gRNA plasmid targeting mouse Kcmf1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only