We narrowed to 19,449 results for: cat
-
Plasmid#74051Purposeretroviral expression plasmid for human histone H4 with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman Histone-H4 (H4C16 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianPromoterpMSCV-LTRsAvailable sinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75237PurposeCRISPR/Cas9 plasmid against human NFATc1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP TEM4 R130D
Plasmid#58895PurposeExpresses GFP Tagged full length TEM4 protein with R130D mutation. Please see notes below for information regarding the L722F mutation in TEM4.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTEM4 (ARHGEF17 Human)
TagsEGFPExpressionMammalianMutationR130D, L722FPromoterCMVAvailable sinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
Swachmann-Bodian-Diamond Syndrome Gene, sbds_R (OZ546)
Plasmid#28071DepositorInsertZinc finger array targeting Swachmann-Bodian-Diamond Syndrome Gene, sbds (sbds Zebrafish)
UseZebrafish targetingAvailable sinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 - myc ULK1 k46I
Plasmid#27624DepositorInsertmouse myc ULK1 K46I (Myc Mouse)
UseGateway CloningTagsmycMutationInitial M from ULK1 removed. Silent mutation at A…Available sinceFeb. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-CUL1 delta 610-615
Plasmid#19941DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertcullin 1 delta 610-615 (CUL1 Human)
TagsHAExpressionMammalianMutationCUL1 with a ROC1 binding mutantAvailable sinceApril 28, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMXs-EGFP-ERas delCAAX-IP
Plasmid#13834DepositorInsertERas delCAAX (Eras Mouse)
UseRetroviralTagsEGFPExpressionMammalianMutationDeletion 4 amino acids of c-terminal end (CAAX mo…Available sinceMarch 16, 2007AvailabilityAcademic Institutions and Nonprofits only -
HOXC6 (human) HIS-tag pET
Plasmid#8565DepositorInsertHOXC6 (HOXC6 Human)
TagsHis and T7ExpressionBacterialMutationThis protein starts at an internal Met initially …Available sinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas13-NES-eNAT10
Plasmid#238299PurposeExpresses cytoplasmic version of the programmable RNA acetylation system.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdPspCas13b fused to eNAT10 (NAT10 Prevotella sp. P5-125, Human)
UseCRISPRTagsHIV NES (C terminal of dPspCas13b)ExpressionMammalianMutationH133A for catalytically inactive mutant, deletion…Available sinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4f-NGR-WPRE
Plasmid#234454PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRM56 tet-AR(1-707)C617Y
Plasmid#183504PurposeLentiviral vector expressing a doxycycline-inducible truncated DNA-binding mutant androgen receptor (AR mutant C617Y)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralExpressionMammalianMutationTruncated mutant AR; spans AR 1-707 aa, and conta…PromoterCMVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag-neo-PP1-Alpha-H248K
Plasmid#171268PurposeMammalian expression of 3x-Flag-tagged human PP1 alpha catalytic subunit H248K mutant that loses enzymatic activityDepositorInsert3x-Flag-tagged human PP1 alpha catalytic subunit H248K mutant (PPP1CA Human)
TagsFlagExpressionMammalianMutationPPP1CA-His248Lys (H248K)PromoterCMVAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046942
Plasmid#145757PurposeBacterial Expression plasmid for SARS-CoV-2 nsp6DepositorInsertSARS-CoV-2 nsp6 (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHISExpressionBacterialMutationwtPromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available sinceApril 28, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001147498)
Plasmid#77789Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC-SUR-YR
Plasmid#61768PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing sulfonylurea resistance gene (ILV alelle from Magnaporthe oyrzae) on transfer DNA (TDNA).DepositorInsertsSur gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromoterMagnaporthe oryzae ILV promoterAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW1-mutant
Plasmid#17795DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 199 to Alanine; Proline 202 to AlanineAvailable sinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW2-mutant
Plasmid#17796DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 258 to Alanine Proline 261 to AlanineAvailable sinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgMark2-mU6-sgMark3-hU6-sgMark4
Plasmid#177235PurposeExpresses Mark2 (bU6), Mark3 (mU6) and Mark4 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgMark2/sgMark3/sgMark4
UseLentiviralPromoterbU6/mU6/hU6Available sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEsg1-6K-Luc
Plasmid#15394DepositorInsertUpstream region of mouse Esg1 gene (Dppa5a Mouse)
UseLuciferaseAvailable sinceFeb. 8, 2008AvailabilityAcademic Institutions and Nonprofits only