We narrowed to 24,867 results for: promoter
-
-
TLCV2
Plasmid#87360PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression.DepositorHas ServiceCloning Grade DNAInsertCas9-2A-eGFP
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsCas9-T2A-eGFPExpressionMammalianPromoterTight TRE promoterAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
HBV 1.3-mer X-null replicon
Plasmid#65461Purposecontaining 1.3 units of the X-null HBV genome (subtype ayw)DepositorInsert1.3 units of the X-null HBV genome
ExpressionMammalianAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSPObooster
Plasmid#216160PurposePlasmid expressing the RME1(ins-308A) and MKT1(30G) genes from S. cerevisiae to correct sporulation defect of S288C derived yeast lab strainsDepositorExpressionYeastMutationMKT1 gene containing an aspartic acid to glycine …Promoterendogenous promoterAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-HA-hYTHDC1
Plasmid#85167PurposeExpression of FLAG-HA-tagged human YTHDC1DepositorAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro-ARID1A
Plasmid#39478PurposeTetracycline-inducible lentiviral expression of human ARID1A; 3rd generation lentiviral vectorDepositorAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-TAZ
Plasmid#32839DepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
HA-TAZ-S89A
Plasmid#32840DepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG
Plasmid#70183PurposeInducible expression of guide RNA with fluorescent GFP reporterDepositorInsertH1-Tet-sgrna cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAW62.YY1.FKBP.knock-in.mCherry
Plasmid#104370PurposeFor knocking in FKBP F36V P2A mCherry onto YY1DepositorInsertFKBP12(F36V) -P2A-mCherry
Available SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mito-TagRFP-T
Plasmid#174543Purposelabels mitochondria with TagRFP-TDepositorInsertMTS-tagRFP-T
UseLentiviralTagstagRFP-TExpressionMammalianAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNAHA
Plasmid#44169DepositorInsertshemagglutinin gene
neuraminidase gene
ExpressionMammalianMutationT55APromoterCMV enhancer/human Ferritin light chain promoter …Available SinceMay 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shRNA E-cadherin
Plasmid#18801DepositorAvailable SinceJuly 22, 2008AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EGFP
Plasmid#91975PurposeEGFP reporter cell line control (no miR-19 sites)DepositorInsertEGFP
UseRetroviralExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGK/CMV)
Plasmid#172330PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato 2a HSVtk 2a Neo followed by an PGK/CMV promoter driving nuclear d2eGFP E2A HygromycinDepositorInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterPGK/CMVAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
HIVGKO
Plasmid#112234PurposeHIVGKO contains a codon-switched eGFP under the control of the HIV-1 specific promoter, and mKO2 under the control of the constitutive promoter EF1aDepositorInsertcsGFP-EF1a-mKO2
UseLentiviralAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZW6 (CK2alpha)
Plasmid#27086DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Parkin
Plasmid#17613DepositorAvailable SinceApril 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc3-CUL4B
Plasmid#19922DepositorAvailable SinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only
