We narrowed to 27,179 results for: RON
-
Plasmid#240702PurposeRSF1010 origin of replication plasmid containing Ebu1 recombitron with extended a1 a2 regions with a donor in the ncRNA targeting lacZ locus in Citrobacter freundii ATCC 8090 expressed by Pm promoterDepositorInsertEbu1 RT, Ebu1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationExtended a1 a2 regionsAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Abe1
Plasmid#240683PurposeRSF1010 origin of replication plasmid containing Abe1 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertAbe1 RT, Abe1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO-NES
Plasmid#238918PurposeMammalian expression of DAAO with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-229E-nsp7
Plasmid#168956PurposeGateway-compatible Entry vectorDepositorInsertHCoV-229E-nsp7 (HCoV229Egp1 )
UseGateway-compatible entry vectorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-229E-nsp1
Plasmid#168952PurposeGateway-compatible Entry vectorDepositorInsertHCoV-229E-nsp1 (HCoV229Egp1 )
UseGateway-compatible entry vectorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-OC43-NS2
Plasmid#168942PurposeGateway-compatible Entry vectorDepositorInsertHCoV-OC43-NS2 (ns2 )
UseGateway-compatible entry vectorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-OC43-nsp15
Plasmid#168940PurposeGateway-compatible Entry vectorDepositorInsertHCoV-OC43-nsp15 (ORF1ab )
UseGateway-compatible entry vectorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-HKU1-nsp16
Plasmid#168901PurposeGateway-compatible Entry vectorDepositorInsertHCoV-HKU1-nsp16 (ORF1ab )
UseGateway-compatible entry vectorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-HKU1-nsp15
Plasmid#168900PurposeGateway-compatible Entry vectorDepositorInsertHCoV-HKU1-nsp15 (ORF1ab )
UseGateway-compatible entry vectorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_SARS-CoV-1-ORF9b
Plasmid#168860PurposeGateway-compatible Entry vectorDepositorInsertSARS-CoV-1-ORF9b (sars9b )
UseGateway-compatible entry vectorAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_SARS-CoV-1-nsp5
Plasmid#168847PurposeGateway-compatible Entry vectorDepositorInsertSARS-CoV-1-nsp5 (ORF1ab )
UseGateway-compatible entry vectorAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_MERS-CoV-Membrane
Plasmid#168832PurposeGateway-compatible Entry vectorDepositorInsertMERS-CoV-Membrane (M )
UseGateway-compatible entry vectorAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEntry_MERS-CoV-nsp16
Plasmid#168826PurposeGateway-compatible Entry vectorDepositorInsertMERS-CoV-nsp16 (orf1ab )
UseGateway-compatible entry vectorAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-pri-miR-137
Plasmid#235159PurposeExpresses EGFP and miR-137 primary transcript in a Cre recombinase-dependent mannerDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rev(CMV-TagBFP2)-EFS-mCherry-124-MUT-MRE
Plasmid#235148PurposeExpresses the mCherry-based mutated (control) sensor for miR-124. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a mutated miR-124 MRE
UseAAVMutation7 nucleotides of the miR-124 WT MRE mutatedPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT478
Plasmid#228286PurposeConstitutive mutant rPhlTA expression with strong promoterDepositorInsertrphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only