We narrowed to 7,378 results for: ESP
-
-
-
-
pCS2+ HA BEX3
Plasmid#231004PurposeTransient overexpression of human BEX3 in mammalian cellsDepositorAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-uORF1-MET
Plasmid#214104PurposeMET 5'UTR upstream of mGFP (uORF1 mutated)DepositorInsertMET 5'UTR
UseLentiviralTagsGFPExpressionMammalianMutationuORF1 mutationAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4QE2Crimson
Plasmid#218280PurposeIntroduction of a bicistronic expression cassette of yEGFP and E2Crimson under the control of the SkGAL2 promoterDepositorInsertpURA3>KlURA3>tKlURA3-pSkGAL2>yEGFP>ERBV1.2A>E2Crimson>tURA3
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW ymTq2-d11
Plasmid#205490Purposeexpress ymTq2-d11 as donor control for yAT1.03DepositorInsertymTq2-d11
ExpressionYeastAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-5BoxB-7-FLuc-STOP-CG3548_E
Plasmid#146242PurposeInsect Expression of 5BoxB-7-Fluc-CG3548-3UTRDepositorInsert5BoxB-7-Fluc-CG3548-3UTR
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-5BoxB-73-Fluc-STOP-CG3548_E
Plasmid#146243PurposeInsect Expression of 5BoxB-73-Fluc-CG3548-3UTRDepositorInsert5BoxB-73-Fluc-CG3548-3UTR
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS306-PTDH3-Dimer-1SUMO
Plasmid#190249PurposeExpression dimer-1SUMO component in yeast cellsDepositorInsertdimer-SUMO
ExpressionYeastAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS306-PTDH3-SUMO7-6SIM
Plasmid#190250PurposeExpression SUMO7-SIM6 in yeast cellsDepositorInsert7SUMO-6SIM
ExpressionYeastAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.flex.H2B.RFP
Plasmid#170386PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.flex.H2B.RFP
Plasmid#170374PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.flex.H2B.RFP
Plasmid#170376PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-EBFP2-GMRWhite
Plasmid#165921PurposeBlasticidin resistant 5xQUAS EBFP2 GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-sfGFP-MiniWhite
Plasmid#165922PurposeBlasticidin resistant 5xQUAS sfGFP Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-EBFP2-MiniWhite
Plasmid#165924PurposeBlasticidin resistant 5xQUAS EBFP2 Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only
