We narrowed to 10,395 results for: plasmids 101
- 
  Plasmid#105495PurposepRPF185 derived plasmid encoding an anhydrotetracyclin inducible HupA-SmBiT and HupA-LgBiT fusionsDepositorInsertHupA-SmBiT/HupA-LgBiT
UseAtc-dependent expression in c. difficilePromoterPtetAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only - 
  
pMSCV-TAP mLST8 (aka: GbL)
Plasmid#12575DepositorAvailable SinceSept. 1, 2006AvailabilityAcademic Institutions and Nonprofits only - 
  
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pGL3-Basic-hCYP26A1P-E4-luciferase
Plasmid#135592PurposeShort form DNA fragment of human CYP26A1gene promoter (E4) in pGL3-Basic-luc vectorDepositorInsertShort form promoter of human CYP26A1 gene (E4)
PromoterHuman CYP26A1 promoter (Short Form, E4)Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
pHR_PGK_SNIPR_Notch1 del-NRR
Plasmid#188353PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a Notch1-del-NRR-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_Notch1-NRRdeletion-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
AAV-CAG-FLEX-NEUROD1-T2A-mCherry
Plasmid#178584PurposeCre-dependent expression of NEUROD1 and mCherry under the constitutive promoterDepositorAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
 - 
  
pAAV-alphaCaMKII-E2-Crimson-3XNLS-pA
Plasmid#183803PurposeAAV vector to express nuclear localized E2-Crimson from CaMKIIa promoterDepositorInsertE2-Crimson-NLS
UseAAVTagsNLSAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pYPQ132D2.0
Plasmid#99890PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only - 
  
pUC57-GSX2-tTA-BleoR
Plasmid#161748PurposeTet-ON tTA plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertAdvanced tTA
UseCRISPRExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
pBabe-puro-Flag-TRAF5
Plasmid#102679Purposeretroviral expression plasmid for TRAF5DepositorAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
pLenti-hSyn-Gαi*-BERKY1
Plasmid#158427PurposeBRET biosensor for detection of Gαi-GTP in lentiviral vector pLenti-hSynDepositorInsertLyn11-Nluc-ER/K linker-YFP-KB1753-myc
UseLentiviralTagsmycExpressionMammalianPromoterhSynapsinAvailable SinceSept. 17, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits - 
  
FUP95PDZGW (C5)
Plasmid#74021Purposelentiviral expression of Psd95-EGFP fusionDepositorAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only - 
  
sgRNA1_MYOD1
Plasmid#64136PurposePhotoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only - 
  
sgRNA2_MYOD1
Plasmid#64137PurposePhotoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only - 
  
 - 
  
sgRNA4_MYOD1
Plasmid#64139PurposePhotoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only - 
  
actc1b-mKate2-rab1ab
Plasmid#109606PurposeMuscle specific zebrafish expression of mKate2 fused to rab1abDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
pMC_mNG2(11)_BSDminus_F1
Plasmid#184163PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 1, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only