We narrowed to 6,025 results for: cat.2
-
Plasmid#209961PurposeEntry vector to store Level 0* replication origin partsDepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
SP_H6_Halo_L172Q_KDEL_pBABEpu
Plasmid#183690PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (ER HaloL172Q)DepositorInsertER Halo(L172Q)
UseRetroviralMutationL72Q in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SP_H6_Halo_M21K_F86L_KDEL_pBABEpu
Plasmid#183691PurposeRetroviral expression of ER-targeted metastable Halotag/folding sensor (ER HaloM21K_F86L)DepositorInsertER Halo(M21K_F86L)
UseRetroviralMutationM21K_F86L in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_CHO-Bip_gRNA1
Plasmid#183694PurposeCRISPRa gRNA expression vector for Chinese Hamster Bip (Hspa5)DepositorInsertgRNA targeting chinese hamster Bip (Hspa5)
UseCRISPRAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET30_Halotag_K73T_Jdomain
Plasmid#183693PurposeBacterial expression of ER-targeted metastable Halotag/folding sensor (HaloK73T) fused with J domainDepositorInsertER Halo(K73T)-J domain
ExpressionBacterialMutationK73T in HalotagAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
HySp5-227
Plasmid#192996PurposePlasmid that encodes for Hydra Sp5, lacking the SP box and DNA binding domainDepositorInsertHydra Sp5
TagsHAExpressionMammalianMutationno SP box and DNA binding domainAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
HyWnt3-ΔRep:Luc
Plasmid#192987PurposePlasmid to test the Hydra Wnt3 promoter activity (full deletion of the repressor element)DepositorInsertHydra Wnt3 promoter
ExpressionMammalianMutationRepressor element deletedAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA5
Plasmid#180366Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA6
Plasmid#180367Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA3
Plasmid#180364Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_SMO
Plasmid#183321PurposeAll-in-One CRISPRko system with a guide RNA that targets SMO geneDepositorInsertSMO
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC53
Plasmid#209962PurposeContains Level 0 Part: 5' Connector (5C1CSN with double terminator Tcat+sai) for the construction of Level 1 plasmidsDepositorInsert5' Connector (5C1CSN_Tcat+sai)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_LCLAT1_GREB10
Plasmid#205845PurposeExpress mEGFP-tagged fusion protein, LCLAT1_GREB1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKT07_AAV-hU6-AsDR-EFS-Cre-T2A-hNGFR
Plasmid#256629PurposeAAV vector for delivery of AsCas12a guides and expressing Cre and hNGFR using EFS promoterDepositorTypeEmpty backboneUseAAVAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGMC00003
Plasmid#166720PurposesgRNA against mouse KitlDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1D
Plasmid#183340PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1D
UseLentiviralAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_NTC3
Plasmid#183335PurposeAll-in-One CRISPRko system containing a non-targeting controlDepositorInsertNTC3
UseLentiviralAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRD4
Plasmid#183331PurposeAll-in-One CRISPRko system with a guide RNA that targets BRD4 geneDepositorInsertBRD4
UseLentiviralAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circNUDC_1
Plasmid#215232PurposeSupression of shcircNUDC(5,RI,6)_1 expressionDepositorInsertcircNUDC shRNA 1 (NUDC Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only