We narrowed to 7,748 results for: lenti crispr
-
Plasmid#216097PurposeAll-in-one, knockout, delivers Cas9 & gRNADepositorInsertCas9 [Sp]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10530
Plasmid#239266PurposeExpresses NES-dCas13b-ABI for CRISPR-TO perturbation in the cytoplasm of cell linesDepositorInsertNES-dPspCas13b-EGFP-ABI
UseCRISPR and LentiviralTagsFlag tag and V5 tagExpressionMammalianMutationH133A and H1058A in PspCas13bPromoterEF1aAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_833
Plasmid#216086PurposeCas9 [Sp] knockout targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_832
Plasmid#216085PurposeCas9 [Sp] knockout targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_834
Plasmid#216087PurposeCas9 [Sp] knockout targeting CD59, positive controlDepositorInsertCD59 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10531
Plasmid#239267PurposeExpresses NLS-dCas13b-ABI for CRISPR-TO perturbation in the nucleus of cell linesDepositorInsertNLS-dPspCas13b-EGFP-ABI
UseCRISPR and LentiviralTagsFlag tag and V5 tagExpressionMammalianMutationH133A and H1058A in PspCas13bPromoterEF1aAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_161
Plasmid#216091PurposeCas9 [Sp] CRISPRi targeting CD81, positive controlDepositorInsertCD81 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA089
Plasmid#216105PurposegRNA expression for Cas12a (guide only)DepositorInsertgRNA expression
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_156
Plasmid#216090PurposeCas9 [Sp] CRISPRa targeting CD274, positive controlDepositorInsertCD274 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_118
Plasmid#216089PurposeCas9 [Sp] CRISPRa targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_836
Plasmid#216088PurposeCas9 [Sp] knockout targeting CD55, positive controlDepositorInsertCD55 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRDB_162
Plasmid#216092PurposeCas9 [Sp] CRISPRi targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_789
Plasmid#216078PurposeCROPseq, CMV-driven destination vectorDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and Lentiviral; DestinationAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_166
Plasmid#216093PurposeCas9 [Sp] CRISPRi targeting CD55, positive controlDepositorInsertCD55 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianPromoterEF-1α promoterAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgCXCR4-2
Plasmid#46917PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CXCR4 geneDepositorInsertsUseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA050
Plasmid#216107PurposegDNA expression for Cas9 with ChenF+E trRNA (guide only)DepositorInsertgDNA expression for Cas9 with ChenF+E trRNA
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-Cas9-2XNES-2ERT2
Plasmid#120551PurposeExpress Cas9, 2xNES and 2 tandem ERT2 in mammalian cellsDepositorInsertCas9, NES and ERT2
UseLentiviralExpressionMammalianPromoterEF1αAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBA439
Plasmid#85967PurposePerturb-seq vector backboneDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only