We narrowed to 9,360 results for: CAG
-
Plasmid#213056PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attR4 and attR3DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL5-pegRNA-attL4
Plasmid#213055PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL5 and attL4DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR5
Plasmid#213053PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR5DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
HaloKu70 sgRNA
Plasmid#207583PurposesgRNA for the insert of the HaloTag at the endogenous loci of Ku70.DepositorInsertGAGCAGTAGCCAACATGTCA
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-Tet2
Plasmid#85743PurposeshRNA against mouse Tet2DepositorInsertshRNA Tet2
UseAAVTagsEYFPAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-VARNAM
Plasmid#115552PurposeRed fluorescent voltage indicator for mammalian expressionDepositorInsertVARNAM
TagsGolgi and ER export signalExpressionMammalianPromoterCMV IE94Available SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
OA-1067B
Plasmid#200252PurposepBac-U6-gRNA(doublesex)-3xp3-tdTomatoDepositorInsert4 gRNAs targeting Doublesex
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hNoxa1
Plasmid#58531Purposeexpresses human Noxa1 in mammalian cellsDepositorAvailable SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v2
Plasmid#97082PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v2
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.Control
Plasmid#128749PurposeExpresses control gRNADepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-sgRNA(siteT9)
Plasmid#154832PurposesgRNA for CRISPR/Cas9-mediated targeted integration into genomic site T9 in CHO cellsDepositorInsertsgRNA(siteT9)
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shKGA
Plasmid#110420PurposeshKGA, silence glutaminase KGA isoform, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-tDeg
Plasmid#185403PurposeiRFP670-tDeg fluorogenic proteinDepositorInsertiRFP670-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX-EGFP-g1
Plasmid#107273PurposeeGFP sgRNA-1 and Cas9 expression vector (aka. pX-ps1)DepositorInsertGFP sgRNA-1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only