We narrowed to 15,831 results for: grna
-
Plasmid#135682PurposeConstitutive expression (EF1a promoter) of GFP cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralTagsExpressionMutationPromoterAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-BbsI-crRNA
Plasmid#51026PurposeGenerates crRNA for use in combination with tracrRNADepositorInsertU6-BbsI-crRNA
UseCRISPRTagsExpressionInsectMutationPromoterU6-2Available SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCP5
Plasmid#166107PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shPten.1523
Plasmid#135667PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shPten into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshPten
UseMouse TargetingTagsExpressionMutationPromoterAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-miRE_shRen-Blast
Plasmid#135684PurposeConstitutive expression (CMV promoter) of GFP cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralTagsExpressionMutationPromoterAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-tdTomato-miRE_shRen-Blast
Plasmid#135686PurposeConstitutive expression (CMV promoter) of tdTomato cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralTagsExpressionMutationPromoterAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv3297
Plasmid#241235PurposeCRISPRi gene silencing plasmid with sgRNA (Rv3297) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv3297 sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv2976c
Plasmid#241234PurposeCRISPRi gene silencing plasmid with sgRNA (Rv2976c) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv2976c sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv2464c
Plasmid#241232PurposeCRISPRi gene silencing plasmid with sgRNA (Rv2464c) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv2464c sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv1638
Plasmid#241231PurposeCRISPRi gene silencing plasmid with sgRNA (Rv1638) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv1638 sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv1259
Plasmid#241228PurposeCRISPRi gene silencing plasmid with sgRNA (Rv1259) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv1259 sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv1020
Plasmid#241227PurposeCRISPRi gene silencing plasmid with sgRNA (Rv1020) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv1020 sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv0949
Plasmid#241226PurposeCRISPRi gene silencing plasmid with sgRNA (Rv0949) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv0949 sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv1633
Plasmid#241230PurposeCRISPRi gene silencing plasmid with sgRNA (Rv1633) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv1633 sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv3589
Plasmid#241236PurposeCRISPRi gene silencing plasmid with sgRNA (Rv3589) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv3589 sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv2924c
Plasmid#241233PurposeCRISPRi gene silencing plasmid with sgRNA (Rv2924c) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv2924c sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLJR965_Rv1420
Plasmid#241229PurposeCRISPRi gene silencing plasmid with sgRNA (Rv1420) dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorInsertRv1420 sgRNA
UseTagsExpressionBacterialMutationWTPromoterAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6:3-tevopreq1
Plasmid#190909PurposeExpression of single epegRNA under control of Drosophila U6:3 promoter. Can be used to generate transgenic flies with vermillion+ selection.DepositorInsertEmpty Backbone
UseCRISPRTagsExpressionInsectMutationPromoterAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
UseTagsExpressionMammalianMutationPromoterAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pLenti-CMV-GFP-miRE_shTHUMPD3-Blast
Plasmid#135690PurposeConstitutive expression (CMV promoter) of GFP cDNA plus miRE-embedded shROSA26 (control shRNA), Blasticidin selectionDepositorInsertshRosa26
UseLentiviralTagsExpressionMutationPromoterAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-miRE_shTHUMPD3-Puro
Plasmid#135691PurposeConstitutive expression (CMV promoter) of GFP cDNA plus miRE-embedded shROSA26 (control shRNA), Puromycin selectionDepositorInsertshRosa26
UseLentiviralTagsExpressionMutationPromoterAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-miRE_shSCR-Blast
Plasmid#135688PurposeConstitutive expression (CMV promoter) of GFP cDNA plus miRE-embedded scrambled control shRNA, Blasticidin selectionDepositorInsertshScrambled
UseLentiviralTagsExpressionMutationPromoterAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-miRE_shRen-Puro
Plasmid#135685PurposeConstitutive expression (CMV promoter) of GFP cDNA plus miRE-embedded shRenilla (control shRNA), Puromycin selectionDepositorInsertshRenilla
UseLentiviralTagsExpressionMutationPromoterAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPATZ1.1.0-gDNA
Plasmid#132476PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF449-R.1.0-gDNA
Plasmid#132469PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only