We narrowed to 19,404 results for: MUT
-
Plasmid#96995PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-CXCR4-W161Y
Plasmid#98951PurposeMammalian expression plasmid for N-terminal myc-tagged human CXCR4 mutant W161YDepositorInsertCXCR4 (CXCR4 Human)
TagsSignal/leader sequence from Influenza A virus HA …ExpressionMammalianMutationW161Y: enhanced CXCL12 binding and signalingPromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-CXCR4-W161H
Plasmid#98952PurposeMammalian expression plasmid for N-terminal myc-tagged human CXCR4 mutant W161HDepositorInsertCXCR4 (CXCR4 Human)
TagsSignal/leader sequence from Influenza A virus HA …ExpressionMammalianMutationW161H: enhanced CXCL12 binding and signalingPromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/FGFR2-S252W(Apert) myc
Plasmid#33249DepositorInsertFGFR2 (Fgfr2 Mouse)
TagsHis and MycExpressionMammalianMutationMutation S252W in FGFR2 found in Apert syndrome. …PromoterCMVAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-TOP3B (Y336F)-3xFLAG
Plasmid#249682PurposeExpresses human TOP3B (Y336F; catalytically inactive mutant) with a C-terminal 3xFLAG tag in mammalian cellsDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-TOP3B (R338W)-3xFLAG
Plasmid#249683PurposeExpresses human TOP3B (R338W; "self-trapping" mutant) with a C-terminal 3xFLAG tag in mammalian cellsDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
LV-AR-AAFF
Plasmid#171218PurposeLenti-viral expression of human androgen receptor DNA-binding mutant: K580A-V581A, mutations in the P-box of the zinc finger 1 at the KVFF motif.DepositorInsertAR-AAFF (AR Human)
UseLentiviralTagsFlagExpressionMammalianMutationAR-K580A-V581APromoterEF-1aAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only