We narrowed to 343 results for: Z-ISO
-
Plasmid#197858PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Ap/Cb resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-CD5Flag2-P2A-smAID-mClover
Plasmid#110657PurposeLentiviral vector expressing cell surface Flag-tag and monomeric GFP N-terminaly fused with auxin inducible degronDepositorInsertCD5Flag2-P2A-AID-mClover
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-mClover-smAID-P2A-CD5HA2-bglpA
Plasmid#110655PurposeLentiviral vector expressing cell surface HA-tag and monomeric GFP C-terminaly fused with auxin inducible degronDepositorInsertmClover-AID-P2A-CD5HA2-bglpA
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-CD5HA2-P2A-smAID-mClover
Plasmid#110658PurposeLentiviral vector expressing cell surface HA-tag and monomeric GFP N-terminaly fused with auxin inducible degronDepositorInsertCD5HA2-P2A-AID-mClover
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-mClover-smAID-P2A-CD5Flag2-bglpA
Plasmid#110654PurposeLentiviral vector expressing cell surface Flag-tag and monomeric GFP C-terminaly fused with auxin inducible degronDepositorInsertmClover-AID-P2A-CD5Flag2-bglpA
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-mClover-smAID-P2A-CD5cmyc2-bglpA
Plasmid#110656PurposeLentiviral vector expressing cell surface c-Myc-tag and monomeric GFP C-terminaly fused with auxin inducible degronDepositorInsertmClover-AID-P2A-CD5cmyc2-bglpA
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sema6a.z-AP-His
Plasmid#72038PurposeExpresses the extracellular region of the Sema6A, isoform z protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only